Быстрый заказ

Человек PGK1 Джин ORF экспрессии кДНК клона плазмиды, C-His Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Human PGK1 Информация о продукте «Клон cDNA»
Размер кДНК:1254bp
Описание кДНК:Full length Clone DNA of Homo sapiens phosphoglycerate kinase 1 with C terminal His tag.
Синоним гена:PGKA, MIG10, MGC8947, MGC117307, MGC142128, PGK1
Участок рестрикции:
Последовательность меток:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Человек PGK1 Джин ORF экспрессии кДНК клона плазмиды, C-His Метка on other vectors
Человек PGK1 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG11114-ACGRBS15400
Человек PGK1 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG11114-ACRRBS15400
Человек PGK1 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаHG11114-ANGRBS15400
Человек PGK1 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаHG11114-ANRRBS15400
Человек PGK1 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG11114-CFRBS13340
Человек PGK1 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG11114-CHRBS13340
Человек PGK1 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG11114-CMRBS13340
Человек PGK1 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG11114-CYRBS13340
Человек PGK1 Джин клон кДНК в вектор клонированияHG11114-MRBS5130
Человек PGK1 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG11114-M-FRBS13340
Человек PGK1 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG11114-NFRBS13340
Человек PGK1 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG11114-NHRBS13340
Человек PGK1 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG11114-NMRBS13340
Человек PGK1 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG11114-NYRBS13340
Человек PGK1 Джин ORF экспрессии кДНК клона плазмидыHG11114-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
  • Rush J. et al., 2005, Nat Biotechnol. 23: 94-101.
  • Olsen JV. et al., 2006, Cell. 127: 635-648.
  • Zieker D. et al., 2008, Cell Physiol Biochem. 21 (5-6): 429-36.
  • Jung Y. et al., 2009, Mol Cancer Res. 7 (10): 1595-604.
  • Choudhary C. et al., 2009, Science. 325: 834-40.
  • Size / Price
    Каталог: HG11114-CH
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
        Недавно просмотренные товары
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.