After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Быстрый заказ

Text Size:AAA

Человек PGK1 Джин ORF экспрессии кДНК клона плазмиды, C-His Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Human PGK1 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_000291.3
Размер кДНК:1254bp
Описание кДНК:Full length Clone DNA of Homo sapiens phosphoglycerate kinase 1 with C terminal His tag.
Синоним гена:PGKA, MIG10, MGC8947, MGC117307, MGC142128, PGK1
Виды:Human
переносчик:pCMV3-C-His
Plasmid:
Участок рестрикции:
Последовательность меток:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Человек PGK1 Джин ORF экспрессии кДНК клона плазмиды, C-His Метка on other vectors
Человек PGK1 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG11114-ACGRBS15400
Человек PGK1 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG11114-ACRRBS15400
Человек PGK1 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаHG11114-ANGRBS15400
Человек PGK1 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаHG11114-ANRRBS15400
Человек PGK1 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG11114-CFRBS13340
Человек PGK1 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG11114-CHRBS13340
Человек PGK1 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG11114-CMRBS13340
Человек PGK1 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG11114-CYRBS13340
Человек PGK1 Джин клон кДНК в вектор клонированияHG11114-MRBS5130
Человек PGK1 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG11114-M-FRBS13340
Человек PGK1 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG11114-NFRBS13340
Человек PGK1 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG11114-NHRBS13340
Человек PGK1 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG11114-NMRBS13340
Человек PGK1 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG11114-NYRBS13340
Человек PGK1 Джин ORF экспрессии кДНК клона плазмидыHG11114-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Ссылки
  • Rush J. et al., 2005, Nat Biotechnol. 23: 94-101.
  • Olsen JV. et al., 2006, Cell. 127: 635-648.
  • Zieker D. et al., 2008, Cell Physiol Biochem. 21 (5-6): 429-36.
  • Jung Y. et al., 2009, Mol Cancer Res. 7 (10): 1595-604.
  • Choudhary C. et al., 2009, Science. 325: 834-40.
  • Size / Price
    Каталог: HG11114-CH
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Размер:
    Количество:+-
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
    Изображения
        Недавно просмотренные товары
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
          Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».