After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Быстрый заказ

Text Size:AAA

Человек Pepsinogen C/PGC Джин ORF экспрессии кДНК клона плазмиды, N-Flag Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Human PGC Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_002630.3
Размер кДНК:1167bp
Описание кДНК:Full length Clone DNA of Homo sapiens progastricsin (pepsinogen C) with N terminal Flag tag.
Синоним гена:PEPC, PGII, FLJ99563, PGC
Виды:Human
переносчик:pCMV3-SP-N-FLAG
Plasmid:pCMV3-Flag-PGC
Участок рестрикции:HindIII + XbaI (6kb + 1.21kb)
Последовательность меток:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Описание последовательности:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Human PGC Gene Plasmid Map
Human PGC natural ORF mammalian expression plasmid, N-Flag tag
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Человек Pepsinogen C/PGC Джин ORF экспрессии кДНК клона плазмиды, N-Flag Метка on other vectors
Человек Pepsinogen C/PGC Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG12072-ACGRBS15400
Человек Pepsinogen C/PGC Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG12072-ACRRBS15396
Человек Pepsinogen C/PGC Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG12072-CFRBS13343
Человек Pepsinogen C/PGC Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG12072-CHRBS13343
Человек Pepsinogen C/PGC Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG12072-CMRBS13340
Человек Pepsinogen C/PGC Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG12072-CYRBS13340
Человек Pepsinogen C/PGC Джин клон кДНК в вектор клонированияHG12072-GRBS5132
Человек Pepsinogen C/PGC Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG12072-NFRBS13340
Человек Pepsinogen C/PGC Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG12072-NHRBS13343
Человек Pepsinogen C/PGC Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG12072-NMRBS13343
Человек Pepsinogen C/PGC Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG12072-NYRBS13340
Человек Pepsinogen C/PGC Джин ORF экспрессии кДНК клона плазмидыHG12072-UTRBS13343
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Фон

Pepsinogen C, also known as PGC, is an aspartic proteinase that belongs to the peptidase family A1. Pepsinogen C is synthesized in the gastric mucosa as inactive precursors, known as zymogens. Pepsinogen C contains a prosegment that serves to stabilize the inactive form and prevent entry of the substrate to the active site. At low PH conditions, Pepsinogen C undergoes conversion into active enzyme. Pepsinogen C has been found expressed in all regions of the stomach mucosa and also in the proximal duodenal mucosa. In stomach cancer tissues and cancer cell lines, the expressions of the pepsinogen genes were decreased or lost, in good accordance with their pepsinogen productions. No gross structural changes of the pepsinogen genes were observed in these cancers, but the methylation patterns of the pepsinogen genes were found to be altered in different ways in different cancers. Serum levels of Pepsinogen C are used as a biomarker for certain gastric diseases including Helicobacter pylori related gastritis.

Ссылки
  • Richter C, et al. (1998) Mechanism of activation of the gastric aspartic proteinases: pepsinogen, progastricsin and prochymosin. Biochem J. 1 (335): 481-90.
  • Westerveld BD, et al. (1987) Gastric proteases in Barrett's esophagus. Gastroenterology. 93 (4): 774-8.
  • Ichinose M, et al. (1991) Methylation and expression of human pepsinogen genes in normal tissues and their alteration in stomach cancer. Jpn J Cancer Res. 82 (6): 686-92.
  • Size / Price
    Каталог: HG12072-NF
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Размер:
    Количество:+-
    НаличиеIn Stock
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
    Изображения
    • Human PGC natural ORF mammalian expression plasmid, N-Flag tag
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
      Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».