After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Человек Pepsinogen C/PGC Джин ORF экспрессии кДНК клона плазмиды, C-HA Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Human PGC Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_002630.3
Размер кДНК:1167bp
Описание кДНК:Full length Clone DNA of Homo sapiens progastricsin (pepsinogen C) with C terminal HA tag.
Синоним гена:PEPC, PGII, FLJ99563, PGC
Виды:Human
переносчик:pCMV3-C-HA
Plasmid:
Участок рестрикции:
Последовательность меток:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Человек Pepsinogen C/PGC Джин ORF экспрессии кДНК клона плазмиды, C-HA Метка on other vectors
Человек Pepsinogen C/PGC Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG12072-ACGRBS15400
Человек Pepsinogen C/PGC Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG12072-ACRRBS15400
Человек Pepsinogen C/PGC Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG12072-CFRBS13340
Человек Pepsinogen C/PGC Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG12072-CHRBS13340
Человек Pepsinogen C/PGC Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG12072-CMRBS13340
Человек Pepsinogen C/PGC Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG12072-CYRBS13340
Человек Pepsinogen C/PGC Джин клон кДНК в вектор клонированияHG12072-GRBS5130
Человек Pepsinogen C/PGC Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG12072-NFRBS13340
Человек Pepsinogen C/PGC Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG12072-NHRBS13340
Человек Pepsinogen C/PGC Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG12072-NMRBS13340
Человек Pepsinogen C/PGC Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG12072-NYRBS13340
Человек Pepsinogen C/PGC Джин ORF экспрессии кДНК клона плазмидыHG12072-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Фон

Pepsinogen C, also known as PGC, is an aspartic proteinase that belongs to the peptidase family A1. Pepsinogen C is synthesized in the gastric mucosa as inactive precursors, known as zymogens. Pepsinogen C contains a prosegment that serves to stabilize the inactive form and prevent entry of the substrate to the active site. At low PH conditions, Pepsinogen C undergoes conversion into active enzyme. Pepsinogen C has been found expressed in all regions of the stomach mucosa and also in the proximal duodenal mucosa. In stomach cancer tissues and cancer cell lines, the expressions of the pepsinogen genes were decreased or lost, in good accordance with their pepsinogen productions. No gross structural changes of the pepsinogen genes were observed in these cancers, but the methylation patterns of the pepsinogen genes were found to be altered in different ways in different cancers. Serum levels of Pepsinogen C are used as a biomarker for certain gastric diseases including Helicobacter pylori related gastritis.

Ссылки
  • Richter C, et al. (1998) Mechanism of activation of the gastric aspartic proteinases: pepsinogen, progastricsin and prochymosin. Biochem J. 1 (335): 481-90.
  • Westerveld BD, et al. (1987) Gastric proteases in Barrett's esophagus. Gastroenterology. 93 (4): 774-8.
  • Ichinose M, et al. (1991) Methylation and expression of human pepsinogen genes in normal tissues and their alteration in stomach cancer. Jpn J Cancer Res. 82 (6): 686-92.
  • Size / Price
    Каталог: HG12072-CY
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Размер:
    Количество:+-
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
    Изображения
        Недавно просмотренные товары
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
          Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».