PGAM1 cDNA ORF Clone, Human, C-DDK (Flag®) tag

Cat: HG16274-CF
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All PGAM1 Reagents
CRO Services
Product recommended

All PGAM1 Reagents
PGAM1 cDNA ORF Clone, Human, C-DDK (Flag®) tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
765 bp
Description
Full length Clone DNA of Human phosphoglycerate mutase 1 (brain) with C terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-FLAG
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

PGAM1 cDNA ORF Clone, Human, C-DDK (Flag®) tag Alternative Names
HEL-S-35 cDNA ORF Clone, Human;PGAM-B cDNA ORF Clone, Human;PGAMA cDNA ORF Clone, Human
PGAM1 Background Information
Full Name
phosphoglycerate mutase 1 (brain)

PGAM1 cDNA ORF Clone, Ferret, Related Products

Product Name Catalog#(PDF)
PGAM1 cDNA ORF Clone in Cloning Vector, Ferret FG60089-G
PGAM1 cDNA ORF Clone, Ferret, untagged FG60089-UT
PGAM1 cDNA ORF Clone, Ferret, C-GFPSpark® tag FG60089-ACG
PGAM1 Lentiviral cDNA ORF Clone, Ferret, C-GFPSpark® tag FG60089-ACGLN
PGAM1 cDNA ORF Clone, Ferret, N-GFPSpark® tag FG60089-ANG
PGAM1 cDNA ORF Clone, Ferret, C-OFPSpark® tag FG60089-ACR
PGAM1 cDNA ORF Clone, Ferret, N-OFPSpark® tag FG60089-ANR
PGAM1 cDNA ORF Clone, Ferret, C-DDK (Flag®) tag FG60089-CF
PGAM1 cDNA ORF Clone, Ferret, N-DDK (Flag®) tag FG60089-NF
PGAM1 cDNA ORF Clone, Ferret, C-His tag FG60089-CH
PGAM1 cDNA ORF Clone, Ferret, N-His tag FG60089-NH
PGAM1 cDNA ORF Clone, Ferret, C-HA tag FG60089-CY
PGAM1 cDNA ORF Clone, Ferret, N-HA tag FG60089-NY
PGAM1 cDNA ORF Clone, Ferret, C-Myc tag FG60089-CM
PGAM1 cDNA ORF Clone, Ferret, N-Myc tag FG60089-NM

PGAM1 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
PGAM1 cDNA ORF Clone in Cloning Vector, Mouse MG51194-U
PGAM1 cDNA ORF Clone, Mouse, untagged MG51194-UT
PGAM1 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51194-ACGLN
PGAM1 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51194-ACG
PGAM1 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG51194-ANG
PGAM1 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG51194-ACR
PGAM1 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG51194-ANR
PGAM1 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG51194-CF
PGAM1 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG51194-NF
PGAM1 cDNA ORF Clone, Mouse, C-His tag MG51194-CH
PGAM1 cDNA ORF Clone, Mouse, N-His tag MG51194-NH
PGAM1 cDNA ORF Clone, Mouse, C-HA tag MG51194-CY
PGAM1 cDNA ORF Clone, Mouse, N-HA tag MG51194-NY
PGAM1 cDNA ORF Clone, Mouse, C-Myc tag MG51194-CM
PGAM1 cDNA ORF Clone, Mouse, N-Myc tag MG51194-NM
PGAM1 qPCR Primer Pairs, Mouse MP201078

PGAM1 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
PGAM1 cDNA ORF Clone in Cloning Vector, Human HG16274-G
PGAM1 cDNA ORF Clone, Human, untagged HG16274-UT
PGAM1 cDNA ORF Clone, Human, C-GFPSpark® tag HG16274-ACG
PGAM1 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG16274-ACGLN
PGAM1 cDNA ORF Clone, Human, C-OFPSpark® tag HG16274-ACR
PGAM1 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG16274-NF
PGAM1 cDNA ORF Clone, Human, C-His tag HG16274-CH
PGAM1 cDNA ORF Clone, Human, N-His tag HG16274-NH
PGAM1 cDNA ORF Clone, Human, C-HA tag HG16274-CY
PGAM1 cDNA ORF Clone, Human, N-HA tag HG16274-NY
PGAM1 cDNA ORF Clone, Human, C-Myc tag HG16274-CM
PGAM1 cDNA ORF Clone, Human, N-Myc tag HG16274-NM
info info
添加购物车成功! 添加购物车失败!