PFKM cDNA ORF Clone, Human, C-Myc tag

1/1
Price:
Size:
Number:

PFKM cDNA ORF Clone, Human, C-Myc tag: General Information

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
2388 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human phosphofructokinase, muscle with C terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
Restriction Sites
KpnI + XbaI(pCMV3-C-Myc-KpnI-XbaI)
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

PFKM cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

PFKM cDNA ORF Clone, Human, C-Myc tag: Validated Images

PFKM cDNA ORF Clone, Human, C-Myc tag: Alternative Names

ATP-PFK cDNA ORF Clone, Human; GSD7 cDNA ORF Clone, Human; PFK-1 cDNA ORF Clone, Human; PFK1 cDNA ORF Clone, Human; PFKA cDNA ORF Clone, Human; PFKX cDNA ORF Clone, Human; PPP1R122 cDNA ORF Clone, Human

PFKM Background Information

PFK1, also known as PFKM, is a regulatory glycolytic enzyme. PFK1 converts fructose 6-phosphate and ATP into fructose 1,6-bisphosphate (through PFK-1), fructose 2,6-bisphosphate (through PFK-2) and ADP. It is a muscle-type isozyme. There are three phosphofructokinase isozymes in humans: muscle, liver and platelet. These isozymes function as subunits of the mammalian tetramer phosphofructokinase, which catalyzes the phosphorylation of fructose-6-phosphate to fructose-1,6-bisphosphate. Mutations in PFK1 gene have been related with glycogen storage disease type VII, also identified as Tarui disease.
Full Name
phosphofructokinase, muscle
References
  • Yamasaki T., et al.,(1991), Structure of the entire human muscle phosphofructokinase-encoding gene: a two-promoter system. Gene 104:277-282.
  • Sharma P.M., et al., (1989), Cloning and expression of a human muscle phosphofructokinase cDNA.Gene 77:177-183.
  • Nakajima H., et al.,(1987), Cloning of human muscle phosphofructokinase cDNA.FEBS Lett. 223:113-116.
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait