After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Быстрый заказ

Text Size:AAA

Человек PFK1/PFKM Джин ORF экспрессии кДНК клона плазмиды, C-Myc Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Human PFKM Информация о продукте «Клон cDNA»
Gene_bank_ref_id:BC021203
Размер кДНК:2343bp
Описание кДНК:Full length Clone DNA of Homo sapiens phosphofructokinase, muscle with C terminal Myc tag.
Синоним гена:GSD7, MGC8699, PFK-1, PFK1, PFKA, PFKX, PFKM
Виды:Human
переносчик:pCMV3-C-Myc
Plasmid:
Участок рестрикции:
Последовательность меток:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Человек PFK1/PFKM Джин ORF экспрессии кДНК клона плазмиды, C-Myc Метка on other vectors
Человек PFK1/PFKM Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG14133-ACGRBS16760
Человек PFK1/PFKM Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG14133-ACRRBS16760
Человек PFK1/PFKM Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаHG14133-ANGRBS16760
Человек PFK1/PFKM Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаHG14133-ANRRBS16760
Человек PFK1/PFKM Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG14133-CFRBS14710
Человек PFK1/PFKM Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG14133-CHRBS14710
Человек PFK1/PFKM Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG14133-CMRBS14710
Человек PFK1/PFKM Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG14133-CYRBS14710
Человек PFK1/PFKM Джин клон кДНК в вектор клонированияHG14133-GRBS5130
Человек PFK1/PFKM Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG14133-NFRBS14710
Человек PFK1/PFKM Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG14133-NHRBS14710
Человек PFK1/PFKM Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG14133-NMRBS14710
Человек PFK1/PFKM Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG14133-NYRBS14710
Человек PFK1/PFKM Джин ORF экспрессии кДНК клона плазмидыHG14133-UTRBS14710
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Фон

PFK1, also known as PFKM, is a regulatory glycolytic enzyme. PFK1 converts fructose 6-phosphate and ATP into fructose 1,6-bisphosphate (through PFK-1), fructose 2,6-bisphosphate (through PFK-2) and ADP. It is a muscle-type isozyme. There are three phosphofructokinase isozymes in humans: muscle, liver and platelet. These isozymes function as subunits of the mammalian tetramer phosphofructokinase, which catalyzes the phosphorylation of fructose-6-phosphate to fructose-1,6-bisphosphate. Mutations in PFK1 gene have been related with glycogen storage disease type VII, also identified as Tarui disease.

Size / Price
Каталог: HG14133-CM
Цена по прейскуранту: 
Цена:      (You Save: )
Размер:
Количество:+-
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».