After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Быстрый заказ

Text Size:AAA

Человек PFKL Джин ORF экспрессии кДНК клона плазмиды

ПаспортОбзорыСвязанные продуктыПротоколы
Human PFKL Информация о продукте «Клон cDNA»
Gene_bank_ref_id:BC008964
Размер кДНК:2343bp
Описание кДНК:Full length Clone DNA of Homo sapiens phosphofructokinase, liver.
Синоним гена:DKFZp686G1648, DKFZp686L2097, FLJ30173, FLJ40909, PFK-B, PFKL
Виды:Human
переносчик:pCMV3-untagged
Plasmid:
Участок рестрикции:
Последовательность меток:
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Человек PFKL Джин ORF экспрессии кДНК клона плазмиды on other vectors
Человек PFKL Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG14223-ACGRBS16760
Человек PFKL Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG14223-ACRRBS16760
Человек PFKL Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаHG14223-ANGRBS16760
Человек PFKL Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаHG14223-ANRRBS16760
Человек PFKL Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG14223-CFRBS14710
Человек PFKL Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG14223-CHRBS14710
Человек PFKL Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG14223-CMRBS14710
Человек PFKL Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG14223-CYRBS14710
Человек PFKL Джин клон кДНК в вектор клонированияHG14223-GRBS5130
Человек PFKL Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG14223-NFRBS14710
Человек PFKL Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG14223-NHRBS14710
Человек PFKL Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG14223-NMRBS14710
Человек PFKL Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG14223-NYRBS14710
Человек PFKL Джин ORF экспрессии кДНК клона плазмидыHG14223-UTRBS14710
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: HG14223-UT
Цена по прейскуранту: 
Цена:      (You Save: )
Размер:
Количество:+-
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
Contact Us
Изображения
      Недавно просмотренные товары
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».