After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Быстрый заказ

Text Size:AAA

Человек PFDN4 / PFD4 Джин ORF экспрессии кДНК клона плазмиды, C-Myc Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Human PFDN4 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:BC010953
Размер кДНК:405bp
Описание кДНК:Full length Clone DNA of Homo sapiens prefoldin subunit 4 with C terminal Myc tag.
Синоним гена:C1, PFD4, PFDN4
Виды:Human
переносчик:pCMV3-C-Myc
Plasmid:
Участок рестрикции:
Последовательность меток:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Человек PFDN4 / PFD4 Джин ORF экспрессии кДНК клона плазмиды, C-Myc Метка on other vectors
Человек PFDN4 / PFD4 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG14144-ACGRBS15396
Человек PFDN4 / PFD4 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG14144-ACRRBS15396
Человек PFDN4 / PFD4 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаHG14144-ANGRBS15396
Человек PFDN4 / PFD4 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаHG14144-ANRRBS15396
Человек PFDN4 / PFD4 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG14144-CFRBS13343
Человек PFDN4 / PFD4 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG14144-CHRBS13343
Человек PFDN4 / PFD4 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG14144-CMRBS13343
Человек PFDN4 / PFD4 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG14144-CYRBS13343
Человек PFDN4 / PFD4 Джин клон кДНК в вектор клонированияHG14144-GRBS5132
Человек PFDN4 / PFD4 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG14144-NFRBS13343
Человек PFDN4 / PFD4 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG14144-NHRBS13343
Человек PFDN4 / PFD4 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG14144-NMRBS13343
Человек PFDN4 / PFD4 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG14144-NYRBS13343
Человек PFDN4 / PFD4 Джин ORF экспрессии кДНК клона плазмидыHG14144-UTRBS13343
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Фон

PFDN4 is a member of the prefoldin beta subunit family. It is one of six subunits of prefoldin, a molecular chaperone complex that binds and stabilizes newly synthesized polypeptides, thereby allowing them to fold correctly. The complex, consisting of two alpha and four beta subunits, forms a double beta barrel assembly with six protruding coiled-coils. PFDN4 binds specifically to cytosolic chaperonin (c-CPN) and transfers target proteins to it. PFDN4 also binds to nascent polypeptide chain and promotes folding in an environment in which there are many competing pathways for nonnative proteins.

Ссылки
  • Iijima M, et al. (1996) Cloning of cDNA with possible transcription factor activity at the G1-S phase transition in human fibroblast cell lines. Acta Med Okayama. 50(2):73-7.
  • Hartl FU, et al. (2002) Molecular chaperones in the cytosol: from nascent chain to folded protein. Science. 295(5561):1852-8.
  • Vainberg I, et al. (1998) Prefoldin, a chaperone that delivers unfolded proteins to cytosolic chaperonin. Cell. 93(5):863-73.
  • Size / Price
    Каталог: HG14144-CM
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Размер:
    Количество:+-
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
    Изображения
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».