After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Быстрый заказ

Text Size:AAA

Человек PEX10 Джин ORF экспрессии кДНК клона плазмиды

ПаспортОбзорыСвязанные продуктыПротоколы
Human PEX10 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:BC018198
Размер кДНК:981bp
Описание кДНК:Full length Clone DNA of Homo sapiens peroxisomal biogenesis factor 10.
Синоним гена:MGC1998, NALD, RNF69, PEX10
Виды:Human
переносчик:pCMV3-untagged
Plasmid:
Участок рестрикции:
Последовательность меток:
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Человек PEX10 Джин ORF экспрессии кДНК клона плазмиды on other vectors
Человек PEX10 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG14224-ACGRBS15400
Человек PEX10 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG14224-ACRRBS15400
Человек PEX10 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаHG14224-ANGRBS15400
Человек PEX10 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаHG14224-ANRRBS15400
Человек PEX10 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG14224-CFRBS13340
Человек PEX10 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG14224-CHRBS13340
Человек PEX10 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG14224-CMRBS13340
Человек PEX10 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG14224-CYRBS13340
Человек PEX10 Джин клон кДНК в вектор клонированияHG14224-GRBS5130
Человек PEX10 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG14224-NFRBS13340
Человек PEX10 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG14224-NHRBS13340
Человек PEX10 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG14224-NMRBS13340
Человек PEX10 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG14224-NYRBS13340
Человек PEX10 Джин ORF экспрессии кДНК клона плазмидыHG14224-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: HG14224-UT
Цена по прейскуранту: 
Цена:      (You Save: )
Размер:
Количество:+-
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
Contact Us
Изображения
      Недавно просмотренные товары
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».