Быстрый заказ

Человек PEX10 Джин ORF экспрессии кДНК клона плазмиды

    ПаспортОбзорыСвязанные продуктыПротоколы
    Человек PEX10 Информация о продукте «Клон cDNA»
    Gene_bank_ref_id:BC018198
    Размер кДНК:981bp
    Описание кДНК:Full length Clone DNA of Homo sapiens peroxisomal biogenesis factor 10.
    Синоним гена:MGC1998, NALD, RNF69, PEX10
    Виды:Human
    переносчик:pCMV3-untagged
    Plasmid:
    Участок рестрикции:
    Последовательность меток:
    Описание последовательности:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    ( We provide with PEX10 qPCR primers for gene expression analysis, HP102874 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Ampicillin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Склад:The lyophilized plasmid can be stored at room temperature for three months.
    Человек PEX10 Джин ORF экспрессии кДНК клона плазмиды on other vectors
    Человек PEX10 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG14224-ACGRBS15400
    Человек PEX10 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG14224-ACRRBS15400
    Человек PEX10 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаHG14224-ANGRBS15400
    Человек PEX10 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаHG14224-ANRRBS15400
    Человек PEX10 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG14224-CFRBS13340
    Человек PEX10 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG14224-CHRBS13340
    Человек PEX10 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG14224-CMRBS13340
    Человек PEX10 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG14224-CYRBS13340
    Человек PEX10 Джин клон кДНК в вектор клонированияHG14224-GRBS5130
    Человек PEX10 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG14224-NFRBS13340
    Человек PEX10 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG14224-NHRBS13340
    Человек PEX10 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG14224-NMRBS13340
    Человек PEX10 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG14224-NYRBS13340
    Человек PEX10 Джин ORF экспрессии кДНК клона плазмидыHG14224-UTRBS13340
     Узнайте больше о векторов экспрессии,
    Product nameProduct name
    Size / Price
    Каталог: HG14224-UT
    Цена по прейскуранту: 
    Цена:      (You Save: )

    Datasheet & Documentation

    Contact Us
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».