Быстрый заказ

Человек PDZD11/PDZK11 Джин ORF экспрессии кДНК клона плазмиды, C-Myc Метка

    ПаспортОбзорыСвязанные продуктыПротоколы
    Человек PDZD11 Информация о продукте «Клон cDNA»
    Размер кДНК:423bp
    Описание кДНК:Full length Clone DNA of Homo sapiens PDZ domain containing 11 with C terminal Myc tag.
    Синоним гена:PISP, AIPP1, PDZK11, PDZD11
    Участок рестрикции:
    Последовательность меток:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
    Описание последовательности:
    ( We provide with PDZD11 qPCR primers for gene expression analysis, HP101818 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Склад:The lyophilized plasmid can be stored at room temperature for three months.
    Myc Tag Info

    A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

    A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

    The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

    Человек PDZD11/PDZK11 Джин ORF экспрессии кДНК клона плазмиды, C-Myc Метка on other vectors
    Человек PDZD11/PDZK11 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG12188-ACGRBS15400
    Человек PDZD11/PDZK11 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG12188-ACRRBS15400
    Человек PDZD11/PDZK11 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG12188-CFRBS13340
    Человек PDZD11/PDZK11 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG12188-CHRBS13340
    Человек PDZD11/PDZK11 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG12188-CMRBS13340
    Человек PDZD11/PDZK11 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG12188-CYRBS13340
    Человек PDZD11/PDZK11 Джин клон кДНК в вектор клонированияHG12188-GRBS5130
    Человек PDZD11/PDZK11 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG12188-NFRBS13340
    Человек PDZD11/PDZK11 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG12188-NHRBS13340
    Человек PDZD11/PDZK11 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG12188-NMRBS13340
    Человек PDZD11/PDZK11 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG12188-NYRBS13340
    Человек PDZD11/PDZK11 Джин ORF экспрессии кДНК клона плазмидыHG12188-UTRBS13340
     Узнайте больше о векторов экспрессии,
    Product nameProduct name

    PDZ domain-containing protein 11, also known as AIPP1a, PISP, PDZD11 and PDZK11, is a cytosolic protein which contains one PDZ (DHR) domain. PDZD11 bears resemblance to members of the MALS / VELIS family of proteins. It contains but one PDZ domain that apparently interacts with the C-terminus of partner proteins. PDZD11 is ubiquitously expressed, and appears to target calcium and copper ATPases to basolateral cell membranes. PDZD11 is a transiently interacting partner of the PMCA b-splice forms that may play a role in their sorting to or from the plasma membrane. Full-length human PDZD11 shares 97% amino acids (aa) identity with mouse PDZD11.

  • Goellner,G.M. et al., 2003, Ann N Y Acad Sci. 986 :461-71.
  • Wolf-Yadlin A., et al., 2007, Proc. Natl. Acad. Sci. USA. 104:5860-5.
  • Heibeck T.H., et al.,2009, J. Proteome Res. 8:3852-61.
  • Size / Price
    Каталог: HG12188-CM
    Цена по прейскуранту: 
    Цена:      (You Save: )

    Datasheet & Documentation

    Contact Us
      Недавно просмотренные товары
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.