After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Быстрый заказ

Text Size:AAA

Человек PDRG1 / C20orf126 Джин ORF экспрессии кДНК клона плазмиды, C-Myc Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Human PDRG1 Информация о продукте «Клон cDNA»
Размер кДНК:402bp
Описание кДНК:Full length Clone DNA of Homo sapiens p53 and DNA-damage regulated 1 with C terminal Myc tag.
Синоним гена:RP1-310O13.8, C20orf126, PDRG, PDRG1
Участок рестрикции:
Последовательность меток:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Человек PDRG1 / C20orf126 Джин ORF экспрессии кДНК клона плазмиды, C-Myc Метка on other vectors
Человек PDRG1 / C20orf126 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG14143-ACGRBS15400
Человек PDRG1 / C20orf126 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG14143-ACRRBS15400
Человек PDRG1 / C20orf126 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаHG14143-ANGRBS15400
Человек PDRG1 / C20orf126 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаHG14143-ANRRBS15400
Человек PDRG1 / C20orf126 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG14143-CFRBS13340
Человек PDRG1 / C20orf126 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG14143-CHRBS13340
Человек PDRG1 / C20orf126 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG14143-CMRBS13340
Человек PDRG1 / C20orf126 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG14143-CYRBS13340
Человек PDRG1 / C20orf126 Джин клон кДНК в вектор клонированияHG14143-GRBS5130
Человек PDRG1 / C20orf126 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG14143-NFRBS13340
Человек PDRG1 / C20orf126 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG14143-NHRBS13340
Человек PDRG1 / C20orf126 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG14143-NMRBS13340
Человек PDRG1 / C20orf126 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG14143-NYRBS13340
Человек PDRG1 / C20orf126 Джин ORF экспрессии кДНК клона плазмидыHG14143-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name

PDRG1, also known as C20orf126, belongs to the prefoldin subunit beta family. It is predominantly expressed in normal testis and exhibits reduced but detectable expression in other organs. PDRG1 may play a role in chaperone-mediated protein folding. PDRG1 is overexpressed in tumors relative to normal tissues. Its expression is upregulated in multiple malignancies including cancers of the colon, rectum, ovary, lung, stomach, breast and uterus when compared to their respective matched normal tissues. Thus PDRG1 is a high-value novel tumor marker that could play a role in cancer development and/or progression.

  • Kim W. et al., 2011, Mol Cell. 44 (2): 325-40.
  • Havugimana PC. et al., 2012, Cell. 150 (5): 1068-81.
  • Jiang L. et al., 2011, Cancer Biol Ther. 11 (6): 567-73.
  • Size / Price
    Каталог: HG14143-CM
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.