Быстрый заказ

Человек PDK-1 Джин ORF экспрессии кДНК клона плазмиды, N-His Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Human PDK1 Информация о продукте «Клон cDNA»
Размер кДНК:1311bp
Описание кДНК:Full length Clone DNA of Homo sapiens pyruvate dehydrogenase kinase, isozyme 1 with N terminal His tag.
Синоним гена:PDK1
Участок рестрикции:
Последовательность меток:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Человек PDK-1 Джин ORF экспрессии кДНК клона плазмиды, N-His Метка on other vectors
Человек PDK-1 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG12312-ACGRBS15400
Человек PDK-1 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG12312-ACRRBS15400
Человек PDK-1 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаHG12312-ANGRBS15400
Человек PDK-1 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаHG12312-ANRRBS15400
Человек PDK-1 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG12312-CFRBS13340
Человек PDK-1 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG12312-CHRBS13340
Человек PDK-1 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG12312-CMRBS13340
Человек PDK-1 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG12312-CYRBS13340
Человек PDK-1 Джин клон кДНК в вектор клонированияHG12312-GRBS5130
Человек PDK-1 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG12312-NFRBS13340
Человек PDK-1 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG12312-NHRBS13340
Человек PDK-1 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG12312-NMRBS13340
Человек PDK-1 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG12312-NYRBS13340
Человек PDK-1 Джин ORF экспрессии кДНК клона плазмидыHG12312-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name

Pyruvate dehydrogenase kinase, isozyme 1, also known as [Pyruvate dehydrogenase [lipoamide]] kinase isozyme 1, mitochondrial and PDK1, is a member of the PDK / BCKDK protein kinase family. PDK-1 is expressed predominantly in the heart. It contains one histidine kinase domain. Pyruvate dehydrogenase kinase (PDK) isoforms are molecular switches that downregulate the pyruvate dehydrogenase complex (PDC) by reversible phosphorylation in mitochondria. An inhibitory effect of lipoic acid on PDKs would result in less phosphorylation of E1 and hence increased PDC activity. At least two isoenzymic forms of pyruvate dehydrogenase kinase ( PDK-1 and PDK-2 ) may be involved in the regulation of enzymatic activity of mammalian pyruvate dehydrogenase complex by phosphorylation. PDK-3 appears to have the highest specific activity among the three isoenzymes. PDK-1 inhibits the mitochondrial pyruvate dehydrogenase complex by phosphorylation of the E1 alpha subunit, thus contributing to the regulation of glucose metabolism.

  • Gudi R., et al., 1995, J. Biol. Chem. 270:28989-94.
  • Mooney,B.P. et al., 2000, Biochem Biophys Res Commun. 267 (2): 500 - 503.
  • Korotchkina,L.G. et al., 2004, Free Radic Res. 38 (10):1083-92.
  • Kato M., et al., 2007, Structure 15: 992-1004.
  • Size / Price
    Каталог: HG12312-NH
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.