After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Быстрый заказ

Text Size:AAA

Человек PDGFRA/CD140a Джин ORF экспрессии кДНК клона плазмиды, N-Flag Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Human PDGFRA Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_006206.4
Размер кДНК:3270bp
Описание кДНК:Full length Clone DNA of Homo sapiens platelet-derived growth factor receptor, alpha polypeptide with N terminal Flag tag.
Синоним гена:CD140A, PDGFR2, MGC74795, Rhe-PDGFRA
Виды:Human
переносчик:pCMV3-SP-N-FLAG
Plasmid:pCMV3-Flag-PDGFRA
Участок рестрикции:HindIII + NotI (6kb + 3.29kb)
Последовательность меток:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Описание последовательности:Identical with the Gene Bank Ref. ID sequence except for the point mutations: 534 C/T, 1719 A/G, 3240 T/C not causing the amino acid variation.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Human PDGFRA Gene Plasmid Map
Human PDGFRα natural ORF mammalian expression plasmid, N-Flag tag
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Человек PDGFRA/CD140a Джин ORF экспрессии кДНК клона плазмиды, N-Flag Метка on other vectors
Человек PDGFRA/CD140a Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG10556-ACGRBS22240
Человек PDGFRA/CD140a Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG10556-ACRRBS22240
Человек PDGFRA/CD140a Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG10556-CFRBS20190
Человек PDGFRA/CD140a Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG10556-CHRBS20190
Человек PDGFRA/CD140a Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG10556-CMRBS20190
Человек PDGFRA/CD140a Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG10556-CYRBS20190
Человек PDGFRA/CD140a Джин клон кДНК в вектор клонированияHG10556-MRBS5130
Человек PDGFRA/CD140a Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG10556-M-YRBS20190
Человек PDGFRA/CD140a Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG10556-NFRBS20190
Человек PDGFRA/CD140a Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG10556-NHRBS20190
Человек PDGFRA/CD140a Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG10556-NMRBS20190
Человек PDGFRA/CD140a Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG10556-NYRBS20190
Человек PDGFRA/CD140a Джин ORF экспрессии кДНК клона плазмидыHG10556-UTRBS20190
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Фон

PDGFRA, also known as CD140a, together with the structurally homolog protein PDGFRB (CD140b), are cell surface receptors for members of the platelet-derived growth factor family. They are members of the class III subfamily of receptor tyrosine kinase (RTKs) with the similar structure characteristics of five immunoglobulin-like domains in their extracellular region and a split kinase domain in their intracellular region. PDGFRA is expressed in oligodendrocyte progenitor cells and mesothelial cell, and binds all three ligand isoforms PDGF-AA, PDGF-BB and PDGF-AB with high affinity, whereas PDGFRB dose not bind PDGF-AA. PDGFRA plays an essential role in regulating proliferation, chemotaxis and migration of mesangial cells. Recent studies have indicated that PDGFRA acts as a critical mediator of signaling in testis organogenesis and Leydig cell differentiation, and in addition, particularly important for kidney development. Additionally, PDGFRA is involved in tumor angiogenesis and maintenance of the tumor microenvironment and has been implicated in development and metastasis of Hepatocellular carcinoma (HCC). PDGFRA may represent a potential therapeutic target in thymic tumours. PDGFRA gene amplification rather than gene mutation may be the underlying genetic mechanism driving PDGFRA overexpression in a portion of gliomas.

Ссылки
  • Oseini AM, et al. (2009) PDGFRalpha: a new therapeutic target in the treatment of hepatocellular carcinoma? Expert Opin Ther Targets. 13(4): 443-54.
  • Meister M, et al. (2009) Expression and mutational status of PDGFR in thymic tumours. Anticancer Res. 29(10): 4057-61.
  • Martinho O, et al. (2009) Expression, mutation and copy number analysis of platelet-derived growth factor receptor A (PDGFRA) and its ligand PDGFA in gliomas. Br J Cancer. 101(6): 973-82.
  • Size / Price
    Каталог: HG10556-NF
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Размер:
    Количество:+-
    НаличиеIn Stock
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
    Изображения
    • Human PDGFRα natural ORF mammalian expression plasmid, N-Flag tag
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
      Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».