After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Быстрый заказ

Text Size:AAA

Человек PDCD4 transcript variant 1 Джин ORF экспрессии кДНК клона плазмиды

ПаспортОбзорыСвязанные продуктыПротоколы
Human PDCD4 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_014456.3
Размер кДНК:1410 bp
Описание кДНК:Full length Clone DNA of Homo sapiens programmed cell death 4 (neoplastic transformation inhibitor), transcript variant 1.
Синоним гена:H731
Виды:Human
переносчик:pCMV3-untagged
Plasmid:pCMV3-PDCD4
Участок рестрикции:KpnI + XbaI(6.1kb+1.41kb)
Последовательность меток:
Описание последовательности:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at ambient temperature for three months.
Человек PDCD4 transcript variant 1 Джин ORF экспрессии кДНК клона плазмиды on other vectors
Человек PDCD4 transcript variant 1 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG11193-ACGRBS15400
Человек PDCD4 transcript variant 1 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG11193-ACRRBS15400
Человек PDCD4 transcript variant 1 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаHG11193-ANGRBS15400
Человек PDCD4 transcript variant 1 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаHG11193-ANRRBS15400
Человек PDCD4 transcript variant 1 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG11193-CFRBS13340
Человек PDCD4 transcript variant 1 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG11193-CHRBS13340
Человек PDCD4 transcript variant 1 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG11193-CMRBS13340
Человек PDCD4 transcript variant 1 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG11193-CYRBS13340
Человек PDCD4 transcript variant 1 Джин клон кДНК в вектор клонированияHG11193-MRBS5130
Человек PDCD4 transcript variant 1 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG11193-NFRBS13340
Человек PDCD4 transcript variant 1 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG11193-NHRBS13340
Человек PDCD4 transcript variant 1 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG11193-NMRBS13340
Человек PDCD4 transcript variant 1 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG11193-NYRBS13340
Человек PDCD4 transcript variant 1 Джин ORF экспрессии кДНК клона плазмидыHG11193-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: HG11193-UT
Цена по прейскуранту: 
Цена:      (You Save: )
Размер:
Количество:+-
НаличиеIn Stock
Запрос по оптовому заказуДобавить в корзину
Contact Us
Изображения
      Недавно просмотренные товары
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».