Быстрый заказ

Человек PDCD4 transcript variant 1 Джин ORF экспрессии кДНК клона плазмиды

  • other Green fluorescent protein / GFP Gene Plasmid Map 5613
ПаспортОбзорыСвязанные продуктыПротоколы
Человек PDCD4 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_014456.3
Размер кДНК:1410 bp
Описание кДНК:Full length Clone DNA of Homo sapiens programmed cell death 4 (neoplastic transformation inhibitor), transcript variant 1.
Синоним гена:H731
Виды:Human
переносчик:pCMV3-untagged
Plasmid:pCMV3-PDCD4
Участок рестрикции:KpnI + XbaI(6.1kb+1.41kb)
Последовательность меток:
Описание последовательности:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
( We provide with PDCD4 qPCR primers for gene expression analysis, HP101098 )
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicillin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at ambient temperature for three months.
Человек PDCD4 transcript variant 1 Джин ORF экспрессии кДНК клона плазмиды on other vectors
Человек PDCD4 transcript variant 1 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG11193-ACGRBS15400
Человек PDCD4 transcript variant 1 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG11193-ACRRBS15400
Человек PDCD4 transcript variant 1 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаHG11193-ANGRBS15400
Человек PDCD4 transcript variant 1 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаHG11193-ANRRBS15400
Человек PDCD4 transcript variant 1 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG11193-CFRBS13340
Человек PDCD4 transcript variant 1 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG11193-CHRBS13340
Человек PDCD4 transcript variant 1 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG11193-CMRBS13340
Человек PDCD4 transcript variant 1 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG11193-CYRBS13340
Человек PDCD4 transcript variant 1 Джин клон кДНК в вектор клонированияHG11193-MRBS5130
Человек PDCD4 transcript variant 1 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG11193-NFRBS13340
Человек PDCD4 transcript variant 1 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG11193-NHRBS13340
Человек PDCD4 transcript variant 1 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG11193-NMRBS13340
Человек PDCD4 transcript variant 1 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG11193-NYRBS13340
Человек PDCD4 transcript variant 1 Джин ORF экспрессии кДНК клона плазмидыHG11193-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: HG11193-UT
Цена по прейскуранту: 
Цена:      (You Save: )

Datasheet & Documentation

Contact Us
    Недавно просмотренные товары
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
      Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».