Быстрый заказ

Человек PCSK2 Джин ORF экспрессии кДНК клона плазмиды, N-Myc Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Human PCSK2 Информация о продукте «Клон cDNA»
Размер кДНК:1917bp
Описание кДНК:Full length Clone DNA of Homo sapiens proprotein convertase subtilisin/kexin type 2 with N terminal Myc tag.
Синоним гена:PC2, NEC2, SPC2, PCSK2
Участок рестрикции:KpnI + XbaI (6kb + 1.94kb)
Последовательность меток:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Описание последовательности:Identical with the Gene Bank Ref. ID sequence.
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Human PCSK2 Gene Plasmid Map
Human PCSK2 ORF mammalian expression plasmid, N-Myc tag
Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Человек PCSK2 Джин ORF экспрессии кДНК клона плазмиды, N-Myc Метка on other vectors
Человек PCSK2 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG13086-ACGRBS16764
Человек PCSK2 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG13086-ACRRBS16764
Человек PCSK2 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаHG13086-ANGRBS16764
Человек PCSK2 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаHG13086-ANRRBS16764
Человек PCSK2 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG13086-CFRBS14711
Человек PCSK2 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG13086-CHRBS14711
Человек PCSK2 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG13086-CMRBS14711
Человек PCSK2 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG13086-CYRBS14711
Человек PCSK2 Джин клон кДНК в вектор клонированияHG13086-GRBS5132
Человек PCSK2 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG13086-NFRBS14711
Человек PCSK2 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG13086-NHRBS14711
Человек PCSK2 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG13086-NMRBS14711
Человек PCSK2 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG13086-NYRBS14711
Человек PCSK2 Джин ORF экспрессии кДНК клона плазмидыHG13086-UTRBS14711
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: HG13086-NM
Цена по прейскуранту: 
Цена:      (You Save: )
НаличиеIn Stock
Запрос по оптовому заказуДобавить в корзину
Contact Us
  • Human PCSK2 ORF mammalian expression plasmid, N-Myc tag
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.