After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Быстрый заказ

Text Size:AAA

Человек PCDHGC4 Джин ORF экспрессии кДНК клона плазмиды, C-His Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Human PCDHGC4 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:BC101035
Размер кДНК:2616bp
Описание кДНК:Full length Clone DNA of Homo sapiens protocadherin gamma subfamily C, 4 with C terminal His tag.
Синоним гена:PCDH-GAMMA-C4
Виды:Human
переносчик:pCMV3-C-His
Plasmid:
Участок рестрикции:
Последовательность меток:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Человек PCDHGC4 Джин ORF экспрессии кДНК клона плазмиды, C-His Метка on other vectors
Человек PCDHGC4 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG15753-ACGRBS22240
Человек PCDHGC4 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG15753-ACRRBS22240
Человек PCDHGC4 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG15753-CFRBS20190
Человек PCDHGC4 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG15753-CHRBS20190
Человек PCDHGC4 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG15753-CMRBS20190
Человек PCDHGC4 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG15753-CYRBS20190
Человек PCDHGC4 Джин клон кДНК в вектор клонированияHG15753-GRBS5130
Человек PCDHGC4 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG15753-NFRBS20190
Человек PCDHGC4 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG15753-NHRBS20190
Человек PCDHGC4 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG15753-NMRBS20190
Человек PCDHGC4 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG15753-NYRBS20190
Человек PCDHGC4 Джин ORF экспрессии кДНК клона плазмидыHG15753-UTRBS20190
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: HG15753-CH
Цена по прейскуранту: 
Цена:      (You Save: )
Размер:
Количество:+-
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».