Быстрый заказ

Text Size:AAA

Человек PCDHGA5 Джин ORF экспрессии кДНК клона плазмиды, C-His Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Human PCDHGA5 Информация о продукте «Клон cDNA»
Размер кДНК:2442bp
Описание кДНК:Full length Clone DNA of Homo sapiens protocadherin gamma subfamily A, 5 with C terminal His tag.
Участок рестрикции:
Последовательность меток:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Человек PCDHGA5 Джин ORF экспрессии кДНК клона плазмиды, C-His Метка on other vectors
Человек PCDHGA5 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG13390-ACGRBS16760
Человек PCDHGA5 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG13390-ACRRBS16760
Человек PCDHGA5 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG13390-CFRBS14710
Человек PCDHGA5 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG13390-CHRBS14710
Человек PCDHGA5 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG13390-CMRBS14710
Человек PCDHGA5 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG13390-CYRBS14710
Человек PCDHGA5 Джин клон кДНК в вектор клонированияHG13390-GRBS5130
Человек PCDHGA5 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG13390-NFRBS14710
Человек PCDHGA5 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG13390-NHRBS14710
Человек PCDHGA5 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG13390-NMRBS14710
Человек PCDHGA5 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG13390-NYRBS14710
Человек PCDHGA5 Джин ORF экспрессии кДНК клона плазмидыHG13390-UTRBS14710
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: HG13390-CH
Цена по прейскуранту: 
Цена:      (You Save: )
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
Contact Us
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.