Быстрый заказ

Человек PCDHGA2 Джин ORF экспрессии кДНК клона плазмиды, C-His Метка

    ПаспортОбзорыСвязанные продуктыПротоколы
    Человек PCDHGA2 Информация о продукте «Клон cDNA»
    Gene_bank_ref_id:NM_032009.1
    Размер кДНК:2472bp
    Описание кДНК:Full length Clone DNA of Homo sapiens protocadherin gamma subfamily A, 2 with C terminal His tag.
    Синоним гена:PCDH-GAMMA-A2, PCDHGA2
    Виды:Human
    переносчик:pCMV3-C-His
    Plasmid:
    Участок рестрикции:
    Последовательность меток:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
    Описание последовательности:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    ( We provide with PCDHGA2 qPCR primers for gene expression analysis, HP102095 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Склад:The lyophilized plasmid can be stored at room temperature for three months.
    His Tag Info

    A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

    Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

    Человек PCDHGA2 Джин ORF экспрессии кДНК клона плазмиды, C-His Метка on other vectors
    Человек PCDHGA2 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG13391-ACGRBS16760
    Человек PCDHGA2 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG13391-ACRRBS16760
    Человек PCDHGA2 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG13391-CFRBS14710
    Человек PCDHGA2 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG13391-CHRBS14710
    Человек PCDHGA2 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG13391-CMRBS14710
    Человек PCDHGA2 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG13391-CYRBS14710
    Человек PCDHGA2 Джин клон кДНК в вектор клонированияHG13391-GRBS5130
    Человек PCDHGA2 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG13391-NFRBS14710
    Человек PCDHGA2 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG13391-NHRBS14710
    Человек PCDHGA2 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG13391-NMRBS14710
    Человек PCDHGA2 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG13391-NYRBS14710
    Человек PCDHGA2 Джин ORF экспрессии кДНК клона плазмидыHG13391-UTRBS14710
     Узнайте больше о векторов экспрессии,
    Product nameProduct name
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».