Быстрый заказ

Человек PCDHGA10 Джин ORF экспрессии кДНК клона плазмиды, C-His Метка

    ПаспортОбзорыСвязанные продуктыПротоколы
    Человек PCDHGA10 Информация о продукте «Клон cDNA»
    Gene_bank_ref_id:NM_032090.1
    Размер кДНК:2553bp
    Описание кДНК:Full length Clone DNA of Homo sapiens protocadherin gamma subfamily A, 10 with C terminal His tag.
    Синоним гена:PCDH-GAMMA-A10, PCDHGA10
    Виды:Human
    переносчик:pCMV3-C-His
    Plasmid:
    Участок рестрикции:
    Последовательность меток:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
    Описание последовательности:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    ( We provide with PCDHGA10 qPCR primers for gene expression analysis, HP102099 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Склад:The lyophilized plasmid can be stored at room temperature for three months.
    His Tag Info

    A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

    Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

    Человек PCDHGA10 Джин ORF экспрессии кДНК клона плазмиды, C-His Метка on other vectors
    Человек PCDHGA10 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG13395-ACGRBS22240
    Человек PCDHGA10 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG13395-ACRRBS22240
    Человек PCDHGA10 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG13395-CFRBS20190
    Человек PCDHGA10 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG13395-CHRBS20190
    Человек PCDHGA10 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG13395-CMRBS20190
    Человек PCDHGA10 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG13395-CYRBS20190
    Человек PCDHGA10 Джин клон кДНК в вектор клонированияHG13395-GRBS5130
    Человек PCDHGA10 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG13395-NFRBS20190
    Человек PCDHGA10 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG13395-NHRBS20190
    Человек PCDHGA10 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG13395-NMRBS20190
    Человек PCDHGA10 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG13395-NYRBS20190
    Человек PCDHGA10 Джин ORF экспрессии кДНК клона плазмидыHG13395-UTRBS20190
     Узнайте больше о векторов экспрессии,
    Product nameProduct name
    Size / Price
    Каталог: HG13395-CH
    Цена по прейскуранту: 
    Цена:      (You Save: )

    Datasheet & Documentation

    Contact Us
      Недавно просмотренные товары
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».