Быстрый заказ

Человек PCDH12/Protocadherin 12 Джин ORF экспрессии кДНК клона плазмиды, N-Flag Метка

    ПаспортОбзорыСвязанные продуктыПротоколы
    Человек PCDH12 Информация о продукте «Клон cDNA»
    Gene_bank_ref_id:NM_016580.2
    Размер кДНК:3555bp
    Описание кДНК:Full length Clone DNA of Homo sapiens protocadherin 12 with N terminal Flag tag.
    Синоним гена:VECAD2, VE-cadherin-2
    Виды:Human
    переносчик:pCMV3-SP-N-FLAG
    Plasmid:
    Участок рестрикции:
    Последовательность меток:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
    Описание последовательности:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    ( We provide with PCDH12 qPCR primers for gene expression analysis, HP103193 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Склад:The lyophilized plasmid can be stored at room temperature for three months.
    FLAG Tag Info

    FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

    A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

    The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

    Человек PCDH12/Protocadherin 12 Джин ORF экспрессии кДНК клона плазмиды, N-Flag Метка on other vectors
    Человек PCDH12/Protocadherin 12 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG14546-ACGRBS25660
    Человек PCDH12/Protocadherin 12 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG14546-ACRRBS25660
    Человек PCDH12/Protocadherin 12 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG14546-CFRBS23610
    Человек PCDH12/Protocadherin 12 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG14546-CHRBS23610
    Человек PCDH12/Protocadherin 12 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG14546-CMRBS23610
    Человек PCDH12/Protocadherin 12 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG14546-CYRBS23610
    Человек PCDH12/Protocadherin 12 Джин клон кДНК в вектор клонированияHG14546-GRBS5130
    Человек PCDH12/Protocadherin 12 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG14546-NFRBS23610
    Человек PCDH12/Protocadherin 12 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG14546-NHRBS23610
    Человек PCDH12/Protocadherin 12 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG14546-NMRBS23610
    Человек PCDH12/Protocadherin 12 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG14546-NYRBS23610
    Человек PCDH12/Protocadherin 12 Джин ORF экспрессии кДНК клона плазмидыHG14546-UTRBS23610
     Узнайте больше о векторов экспрессии,
    Product nameProduct name
    Size / Price
    Каталог: HG14546-NF
    Цена по прейскуранту: 
    Цена:      (You Save: )

    Datasheet & Documentation

    Contact Us
      Недавно просмотренные товары
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».