Быстрый заказ

Человек PCDH10 Джин ORF экспрессии кДНК клона плазмиды, C-His Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Human PCDH11X Информация о продукте «Клон cDNA»
Размер кДНК:4044bp
Описание кДНК:Full length Clone DNA of Homo sapiens protocadherin 11 X-linked with C terminal His tag.
Синоним гена:PCDHX, PCDH-X, PCDH11, PCDH11X
Участок рестрикции:
Последовательность меток:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Человек PCDH10 Джин ORF экспрессии кДНК клона плазмиды, C-His Метка on other vectors
Человек PCDH10 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG13406-ACGRBS25660
Человек PCDH10 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG13406-ACRRBS25660
Человек PCDH10 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG13406-CFRBS23610
Человек PCDH10 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG13406-CHRBS23610
Человек PCDH10 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG13406-CMRBS23610
Человек PCDH10 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG13406-CYRBS23610
Человек PCDH10 Джин клон кДНК в вектор клонированияHG13406-GRBS5130
Человек PCDH10 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG13406-NFRBS23610
Человек PCDH10 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG13406-NHRBS23610
Человек PCDH10 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG13406-NMRBS23610
Человек PCDH10 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG13406-NYRBS23610
Человек PCDH10 Джин ORF экспрессии кДНК клона плазмидыHG13406-UTRBS23610
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: HG13406-CH
Цена по прейскуранту: 
Цена:      (You Save: )
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
Contact Us
      Недавно просмотренные товары
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.