After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Быстрый заказ

Text Size:AAA

Человек PCDH10 Джин ORF экспрессии кДНК клона плазмиды, C-His Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Human PCDH11X Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_032968.3
Размер кДНК:4044bp
Описание кДНК:Full length Clone DNA of Homo sapiens protocadherin 11 X-linked with C terminal His tag.
Синоним гена:PCDHX, PCDH-X, PCDH11, PCDH11X
Виды:Human
переносчик:pCMV3-C-His
Plasmid:
Участок рестрикции:
Последовательность меток:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Человек PCDH10 Джин ORF экспрессии кДНК клона плазмиды, C-His Метка on other vectors
Человек PCDH10 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG13406-ACGRBS25660
Человек PCDH10 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG13406-ACRRBS25660
Человек PCDH10 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG13406-CFRBS23610
Человек PCDH10 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG13406-CHRBS23610
Человек PCDH10 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG13406-CMRBS23610
Человек PCDH10 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG13406-CYRBS23610
Человек PCDH10 Джин клон кДНК в вектор клонированияHG13406-GRBS5130
Человек PCDH10 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG13406-NFRBS23610
Человек PCDH10 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG13406-NHRBS23610
Человек PCDH10 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG13406-NMRBS23610
Человек PCDH10 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG13406-NYRBS23610
Человек PCDH10 Джин ORF экспрессии кДНК клона плазмидыHG13406-UTRBS23610
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: HG13406-CH
Цена по прейскуранту: 
Цена:      (You Save: )
Размер:
Количество:+-
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
Contact Us
Изображения
      Недавно просмотренные товары
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».