Быстрый заказ

Text Size:AAA

Человек PCBP1 Джин ORF экспрессии кДНК клона плазмиды, C-Flag Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Human PCBP1 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_006196.3
Размер кДНК:1071bp
Описание кДНК:Full length Clone DNA of Homo sapiens poly(rC) binding protein 1 with C terminal Flag tag.
Синоним гена:HNRPX, HNRPE1, hnRNP-X, hnRNP-E1, PCBP1
Виды:Human
переносчик:pCMV3-C-FLAG
Plasmid:
Участок рестрикции:
Последовательность меток:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Человек PCBP1 Джин ORF экспрессии кДНК клона плазмиды, C-Flag Метка on other vectors
Человек PCBP1 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG11628-ACGRBS15400
Человек PCBP1 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG11628-ACRRBS15400
Человек PCBP1 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаHG11628-ANGRBS15400
Человек PCBP1 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаHG11628-ANRRBS15400
Человек PCBP1 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG11628-CFRBS13340
Человек PCBP1 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG11628-CHRBS13340
Человек PCBP1 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG11628-CMRBS13340
Человек PCBP1 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG11628-CYRBS13340
Человек PCBP1 Джин клон кДНК в вектор клонированияHG11628-MRBS5130
Человек PCBP1 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG11628-NFRBS13340
Человек PCBP1 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG11628-NHRBS13340
Человек PCBP1 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG11628-NMRBS13340
Человек PCBP1 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG11628-NYRBS13340
Человек PCBP1 Джин ORF экспрессии кДНК клона плазмидыHG11628-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Фон

Poly(rC)-binding protein 1, also known as Heterogeneous nuclear ribonucleoprotein E1, Alpha-CP1, Nucleic acid-binding protein SUB2.3 and PCBP1, is a family member of heterogeneous nuclear ribonucleoproteins (hnRNPs) that belong to RNA-binding proteins and bear three KH domains. PCBP1 is loosely bound in the nucleus. It may shuttle between the nucleus and the cytoplasm. It is abundantly expressed in skeletal muscle, thymus and peripheral blood leukocytes while a lower expression is observed in prostate, spleen, testis, ovary, small intestine, heart, liver, adrenal and thyroid glands. PCBP1 is widely expressed in many human tissues and involved in regulation of transcription, transportation process, and function of RNA molecules. PCBP1 plays a pivotal role in post-transcriptional regulation for RNA metabolism and RNA function in gene expression. PCBP1 acts as a negative regulator of CD44 variants splicing in HepG2 cells, and loss of PCBP1 in human hepatic tumor contributes to the formation of a metastatic phenotype.

Ссылки
  • Evans,J.R. et al., 2003, Oncogene  22 (39): 8012-20.
  • Huo,L.R. et al., 2008, Biochim Biophys Acta  1784 (11):1524-33.
  • Huo,L.R. et al., 2009, Beijing Da Xue Xue Bao  41 (4):402-8.
  • Zhang,T. et al., 2010, Mol Cancer 9 :72.
  • Size / Price
    Каталог: HG11628-CF
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Размер:
    Количество:+-
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
    Изображения
        Недавно просмотренные товары
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
          Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».