Быстрый заказ

Человек Actopaxin Джин ORF экспрессии кДНК клона плазмиды, C-Flag Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Human PARVA Информация о продукте «Клон cDNA»
Размер кДНК:1119bp
Описание кДНК:Full length Clone DNA of Homo sapiens parvin, alpha with C terminal Flag tag.
Синоним гена:MXRA2, CH-ILKBP
Участок рестрикции:
Последовательность меток:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Человек Actopaxin Джин ORF экспрессии кДНК клона плазмиды, C-Flag Метка on other vectors
Человек Actopaxin Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG13919-ACGRBS15396
Человек Actopaxin Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG13919-ACRRBS15396
Человек Actopaxin Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаHG13919-ANGRBS15396
Человек Actopaxin Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаHG13919-ANRRBS15396
Человек Actopaxin Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG13919-CFRBS13343
Человек Actopaxin Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG13919-CHRBS13343
Человек Actopaxin Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG13919-CMRBS13343
Человек Actopaxin Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG13919-CYRBS13343
Человек Actopaxin Джин клон кДНК в вектор клонированияHG13919-GRBS5132
Человек Actopaxin Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG13919-NFRBS13343
Человек Actopaxin Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG13919-NHRBS13343
Человек Actopaxin Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG13919-NMRBS13343
Человек Actopaxin Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG13919-NYRBS13343
Человек Actopaxin Джин ORF экспрессии кДНК клона плазмидыHG13919-UTRBS13343
 Узнайте больше о векторов экспрессии,
Product nameProduct name

Actopaxin, also known as alpha-parvin, belongs to the parvin family. It is widely expressed, with highest levels in heart, skeletal muscle, kidney and liver. Actopaxin contains 2 CH (calponin-homology) domains and probably plays a role in the regulation of cell adhesion and cytoskeleton organization. It interacts with integrin-linked protein kinase and probably with actin and the LD1 and LD4 motifs of PXN. Actopaxin binds directly to both F-actin and paxillin LD1 and LD4 motifs. Actopaxin also exhibits robust focal adhesion localization in several cultured cell types but is not found along the length of the associated actin-rich stress fibers. It is absent from actin-rich cell-cell adherens junctions.

  • Korenbaum E, et al. (2002) Genomic organization and expression profile of the parvin family of focal adhesion proteins in mice and humans. Gene. 279(1):69-79.
  • Nikolopoulos SN, et al. (2002) Molecular dissection of actopaxin-integrin-linked kinase-Paxillin interactions and their role in subcellular localization. J Biol Chem. 277(2): 1568-75.
  • Tu Y, et al. (2001) A new focal adhesion protein that interacts with integrin-linked kinase and regulates cell adhesion and spreading. J Cell Biol. 153(3): 585-98.
  • Size / Price
    Каталог: HG13919-CF
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.