Быстрый заказ

Человек PARP3 transcript variant 2 Джин ORF экспрессии кДНК клона плазмиды

  • Human PARP3 transcript variant 2 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
ПаспортОбзорыСвязанные продуктыПротоколы
Человек PARP3 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_005485.4
Размер кДНК:1602bp
Описание кДНК:Full length Clone DNA of Homo sapiens poly (ADP-ribose) polymerase family, member 3, transcript variant 2.
Синоним гена:IRT1, ADPRT3, ADPRTL2, ADPRTL3, PADPRT-3, PARP3
Виды:Human
переносчик:pCMV3-untagged
Plasmid:pCMV3-PARP3
Участок рестрикции:KpnI + XbaI (6.1kb + 1.6kb)
Последовательность меток:
Описание последовательности:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
( We provide with PARP3 qPCR primers for gene expression analysis, HP101095 )
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicillin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Человек PARP3 Gene Plasmid Map
Human PARP3 transcript variant 2 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
Человек PARP3 transcript variant 2 Джин ORF экспрессии кДНК клона плазмиды on other vectors
Человек PARP3 transcript variant 2 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG11190-ACGRBS16760
Человек PARP3 transcript variant 2 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG11190-ACRRBS16760
Человек PARP3 transcript variant 2 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаHG11190-ANGRBS16760
Человек PARP3 transcript variant 2 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаHG11190-ANRRBS16760
Человек PARP3 transcript variant 2 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG11190-CFRBS14710
Человек PARP3 transcript variant 2 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG11190-CHRBS14710
Человек PARP3 transcript variant 2 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG11190-CMRBS14710
Человек PARP3 transcript variant 2 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG11190-CYRBS14710
Человек PARP3 transcript variant 2 Джин клон кДНК в вектор клонированияHG11190-MRBS5130
Человек PARP3 transcript variant 2 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG11190-M-FRBS14710
Человек PARP3 transcript variant 2 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG11190-NFRBS14710
Человек PARP3 transcript variant 2 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG11190-NHRBS14710
Человек PARP3 transcript variant 2 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG11190-NMRBS14710
Человек PARP3 transcript variant 2 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG11190-NYRBS14710
Человек PARP3 transcript variant 2 Джин ORF экспрессии кДНК клона плазмидыHG11190-UTRBS14710
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Ссылки
  • Loseva O, et al. (2010) PARP-3 is a mono-ADP-ribosylase that activates PARP-1 in the absence of DNA. J Biol Chem. 285(11): 8054-60.
  • Lehtio L, et al. (2009) Structural basis for inhibitor specificity in human poly(ADP-ribose) polymerase-3. J Med Chem. 52(9): 3108-11.
  • Rouleau M, et al. (2009) Assessment of PARP-3 distribution in tissues of cynomolgous monkeys. J Histochem Cytochem. 57(7): 675-85.
  • Rouleau M, et al. (2007) PARP-3 associates with polycomb group bodies and with components of the DNA damage repair machinery. J Cell Biochem. 100(2): 385-401.
  • Augustin A, et al. (2003) PARP-3 localizes preferentially to the daughter centriole and interferes with the G1/S cell cycle progression. J Cell Sci. 116(Pt 8): 1551-62.
  • Size / Price
    Каталог: HG11190-UT
    Цена по прейскуранту: 
    Цена:      (You Save: )

    Datasheet & Documentation

    Contact Us
      Недавно просмотренные товары
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».