After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Быстрый заказ

Text Size:AAA

Человек PARP3 transcript variant 2 Джин ORF экспрессии кДНК клона плазмиды

ПаспортОбзорыСвязанные продуктыПротоколы
Human PARP3 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_005485.4
Размер кДНК:1602bp
Описание кДНК:Full length Clone DNA of Homo sapiens poly (ADP-ribose) polymerase family, member 3, transcript variant 2.
Синоним гена:IRT1, ADPRT3, ADPRTL2, ADPRTL3, PADPRT-3, PARP3
Виды:Human
переносчик:pCMV3-untagged
Plasmid:pCMV3-PARP3
Участок рестрикции:KpnI + XbaI (6.1kb + 1.6kb)
Последовательность меток:
Описание последовательности:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Human PARP3 Gene Plasmid Map
Human PARP3 transcript variant 2 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
Человек PARP3 transcript variant 2 Джин ORF экспрессии кДНК клона плазмиды on other vectors
Человек PARP3 transcript variant 2 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG11190-ACGRBS16760
Человек PARP3 transcript variant 2 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG11190-ACRRBS16760
Человек PARP3 transcript variant 2 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаHG11190-ANGRBS16760
Человек PARP3 transcript variant 2 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаHG11190-ANRRBS16760
Человек PARP3 transcript variant 2 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG11190-CFRBS14710
Человек PARP3 transcript variant 2 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG11190-CHRBS14710
Человек PARP3 transcript variant 2 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG11190-CMRBS14710
Человек PARP3 transcript variant 2 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG11190-CYRBS14710
Человек PARP3 transcript variant 2 Джин клон кДНК в вектор клонированияHG11190-MRBS5130
Человек PARP3 transcript variant 2 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG11190-M-FRBS14710
Человек PARP3 transcript variant 2 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG11190-NFRBS14710
Человек PARP3 transcript variant 2 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG11190-NHRBS14710
Человек PARP3 transcript variant 2 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG11190-NMRBS14710
Человек PARP3 transcript variant 2 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG11190-NYRBS14710
Человек PARP3 transcript variant 2 Джин ORF экспрессии кДНК клона плазмидыHG11190-UTRBS14710
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Ссылки
  • Loseva O, et al. (2010) PARP-3 is a mono-ADP-ribosylase that activates PARP-1 in the absence of DNA. J Biol Chem. 285(11): 8054-60.
  • Lehtio L, et al. (2009) Structural basis for inhibitor specificity in human poly(ADP-ribose) polymerase-3. J Med Chem. 52(9): 3108-11.
  • Rouleau M, et al. (2009) Assessment of PARP-3 distribution in tissues of cynomolgous monkeys. J Histochem Cytochem. 57(7): 675-85.
  • Rouleau M, et al. (2007) PARP-3 associates with polycomb group bodies and with components of the DNA damage repair machinery. J Cell Biochem. 100(2): 385-401.
  • Augustin A, et al. (2003) PARP-3 localizes preferentially to the daughter centriole and interferes with the G1/S cell cycle progression. J Cell Sci. 116(Pt 8): 1551-62.
  • Size / Price
    Каталог: HG11190-UT
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Размер:
    Количество:+-
    НаличиеIn Stock
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
    Изображения
    • Human PARP3 transcript variant 2 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
      Недавно просмотренные товары
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».