Быстрый заказ

Человек PAK2 Джин ORF экспрессии кДНК клона плазмиды, N-His Метка

    ПаспортОбзорыСвязанные продуктыПротоколы
    Человек PAK2 Информация о продукте «Клон cDNA»
    Gene_bank_ref_id:NM_002577.4
    Размер кДНК:1575bp
    Описание кДНК:Full length Clone DNA of Homo sapiens p21 protein (Cdc42/Rac)-activated kinase 2 with N terminal His tag.
    Синоним гена:PAK2, PAK65, PAKgamma
    Виды:Human
    переносчик:pCMV3-N-His
    Plasmid:
    Участок рестрикции:
    Последовательность меток:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
    Описание последовательности:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    ( We provide with PAK2 qPCR primers for gene expression analysis, HP100171 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Склад:The lyophilized plasmid can be stored at room temperature for three months.
    His Tag Info

    A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

    Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

    Человек PAK2 Джин ORF экспрессии кДНК клона плазмиды, N-His Метка on other vectors
    Человек PAK2 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG10085-ACGRBS16760
    Человек PAK2 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG10085-ACRRBS16760
    Человек PAK2 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаHG10085-ANGRBS16760
    Человек PAK2 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаHG10085-ANRRBS16760
    Человек PAK2 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG10085-CFRBS14710
    Человек PAK2 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG10085-CHRBS14710
    Человек PAK2 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG10085-CMRBS14710
    Человек PAK2 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG10085-CYRBS14710
    Human PAK2 Gene ORF cDNA clone in cloning vectorHG10085-GRBS5130
    Человек PAK2 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG10085-NFRBS14710
    Человек PAK2 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG10085-NHRBS14710
    Человек PAK2 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG10085-NMRBS14710
    Человек PAK2 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG10085-NYRBS14710
    Человек PAK2 Джин ORF экспрессии кДНК клона плазмидыHG10085-UTRBS14710
     Узнайте больше о векторов экспрессии,
    Product nameProduct name
    Size / Price
    Каталог: HG10085-NH
    Цена по прейскуранту: 
    Цена:      (You Save: )

    Datasheet & Documentation

    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».