Быстрый заказ

Text Size:AAA

Человек PAK2 Джин ORF экспрессии кДНК клона плазмиды, N-His Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Human PAK2 Информация о продукте «Клон cDNA»
Размер кДНК:1575bp
Описание кДНК:Full length Clone DNA of Homo sapiens p21 protein (Cdc42/Rac)-activated kinase 2 with N terminal His tag.
Синоним гена:PAK2, PAK65, PAKgamma
Участок рестрикции:
Последовательность меток:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Человек PAK2 Джин ORF экспрессии кДНК клона плазмиды, N-His Метка on other vectors
Человек PAK2 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG10085-ACGRBS16764
Человек PAK2 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG10085-ACRRBS16760
Человек PAK2 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаHG10085-ANGRBS16764
Человек PAK2 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаHG10085-ANRRBS16760
Человек PAK2 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG10085-CFRBS14710
Человек PAK2 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG10085-CHRBS14711
Человек PAK2 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG10085-CMRBS14711
Человек PAK2 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG10085-CYRBS14711
Человек PAK2 Джин клон кДНК в вектор клонированияHG10085-MRBS5132
Человек PAK2 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG10085-NFRBS14711
Человек PAK2 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG10085-NHRBS14711
Человек PAK2 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG10085-NMRBS14711
Человек PAK2 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG10085-NYRBS14711
Человек PAK2 Джин ORF экспрессии кДНК клона плазмидыHG10085-UTRBS14711
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: HG10085-NH
Цена по прейскуранту: 
Цена:      (You Save: )
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
Contact Us
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.