After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Человек PAH / PH Джин ORF экспрессии кДНК клона плазмиды, C-HA Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Human PAH Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_000277.1
Размер кДНК:1359bp
Описание кДНК:Full length Clone DNA of Homo sapiens phenylalanine hydroxylase with C terminal HA tag.
Синоним гена:PH, PKU, PKU1, PAH
Виды:Human
переносчик:pCMV3-C-HA
Plasmid:pCMV3-PAH-HA
Участок рестрикции:KpnI + NotI (6kb + 1.4kb)
Последовательность меток:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Описание последовательности:Identical with the Gene Bank Ref. ID sequence except for the point mutations: 696 A/G, 735 G/A not causing the amino acid variation.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Human PAH Gene Plasmid Map
Human PAH natural ORF mammalian expression plasmid, C-HA tag
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Человек PAH / PH Джин ORF экспрессии кДНК клона плазмиды, C-HA Метка on other vectors
Человек PAH / PH Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG12081-ACGRBS15400
Человек PAH / PH Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG12081-ACRRBS15400
Человек PAH / PH Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаHG12081-ANGRBS15400
Человек PAH / PH Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаHG12081-ANRRBS15400
Человек PAH / PH Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG12081-CFRBS13340
Человек PAH / PH Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG12081-CHRBS13340
Человек PAH / PH Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG12081-CMRBS13340
Человек PAH / PH Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG12081-CYRBS13340
Human PAH Gene cDNA clone plasmidHG12081-GRBS3620
Человек PAH / PH Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG12081-NFRBS13340
Человек PAH / PH Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG12081-NHRBS13340
Человек PAH / PH Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG12081-NMRBS13340
Человек PAH / PH Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG12081-NYRBS13340
Человек PAH / PH Джин клон кДНК в вектор клонированияHG12081-URBS5130
Человек PAH / PH Джин ORF экспрессии кДНК клона плазмидыHG12081-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Фон

PAH (phenylalanine hydroxylase), also known as PH, belongs to the biopterin-dependent aromatic amino acid hydroxylase family. It contains 1 ACT domain, N-terminal region of PAH is thought to contain allosteric binding sites for phenylalanine and to constitute an "inhibitory" domain that regulates the activity of a catalytic domain in the C-terminal portion of the molecule. In humans, PAH is expressed both in the liver and the kidney, and there is some indication that it may be differentially regulated in these tissues. PAH catalyzes the hydroxylation of the aromatic side-chain of phenylalanine to generate tyrosine. It is one of three members of the pterin-dependent amino acid hydroxylases, a class of monooxygenase that uses tetrahydrobiopterin and a non-heme iron for catalysis. Defects in PAH are the cause of phenylketonuria (PKU). PKU is an autosomal recessive inborn error of phenylalanine metabolism, due to severe phenylalanine hydroxylase deficiency. It is characterized by blood concentrations of phenylalanine persistently above 1200 mumol.

Ссылки
  • Fitzpatrick PF, et al. (1999) Tetrahydropterin-dependent amino acid hydroxylases. Annu Rev Biochem. 68:355-81.
  • Olsson E, et al. (2011) Formation of the iron-oxo hydroxylating species in the catalytic cycle of aromatic amino acid hydroxylases. Chemistry. 17(13):3746-58.
  • Bassan A, et al. (2003) Mechanism of aromatic hydroxylation by an activated FeIVO core in tetrahydrobiopterin-dependent hydroxylases. Chemistry. 9(17):4055-67.
  • Panay AJ, et al. (2011) Evidence for a high-spin Fe(IV) species in the catalytic cycle of a bacterial phenylalanine hydroxylase. Biochemistry. 50(11):1928-33.
  • Bassan A, et al. (2003) Mechanism of dioxygen cleavage in tetrahydrobiopterin-dependent amino acid hydroxylases. Chemistry. 9(1):106-15.
  • Size / Price
    Каталог: HG12081-CY
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Размер:
    Количество:+-
    НаличиеIn Stock
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
    Изображения
    • Human PAH natural ORF mammalian expression plasmid, C-HA tag
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
      Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».