After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Быстрый заказ

Text Size:AAA

Человек PAF1 Джин ORF экспрессии кДНК клона плазмиды, C-His Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Human PAF1 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_019088.3
Размер кДНК:1596bp
Описание кДНК:Full length Clone DNA of Homo sapiens Paf1, RNA polymerase II associated factor, homolog (S. cerevisiae) with C terminal His tag.
Синоним гена:PD2, F23149_1
Виды:Human
переносчик:pCMV3-C-His
Plasmid:
Участок рестрикции:
Последовательность меток:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Человек PAF1 Джин ORF экспрессии кДНК клона плазмиды, C-His Метка on other vectors
Человек PAF1 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG16333-ACGRBS16760
Человек PAF1 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG16333-ACRRBS16760
Человек PAF1 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаHG16333-ANGRBS16760
Человек PAF1 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаHG16333-ANRRBS16760
Человек PAF1 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG16333-CFRBS14710
Человек PAF1 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG16333-CHRBS14710
Человек PAF1 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG16333-CMRBS14710
Человек PAF1 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG16333-CYRBS14710
Человек PAF1 Джин клон кДНК в вектор клонированияHG16333-GRBS5130
Человек PAF1 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG16333-NFRBS14710
Человек PAF1 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG16333-NHRBS14710
Человек PAF1 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG16333-NMRBS14710
Человек PAF1 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG16333-NYRBS14710
Человек PAF1 Джин ORF экспрессии кДНК клона плазмидыHG16333-UTRBS14710
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: HG16333-CH
Цена по прейскуранту: 
Цена:      (You Save: )
Размер:
Количество:+-
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
Contact Us
Изображения
      Недавно просмотренные товары
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».