After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Быстрый заказ

Text Size:AAA

Человек PACRG Джин ORF экспрессии кДНК клона плазмиды, N-HA Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Human PACRG Информация о продукте «Клон cDNA»
Gene_bank_ref_id:BC030642
Размер кДНК:774bp
Описание кДНК:Full length Clone DNA of Homo sapiens PARK2 co-regulated with N terminal HA tag.
Синоним гена:GLUP, PARK2CRG, HAK005771, RP3-495O10.2, PACRG
Виды:Human
переносчик:pCMV3-N-HA
Plasmid:
Участок рестрикции:
Последовательность меток:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Человек PACRG Джин ORF экспрессии кДНК клона плазмиды, N-HA Метка on other vectors
Человек PACRG Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG14044-ACGRBS15396
Человек PACRG Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG14044-ACRRBS15396
Человек PACRG Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаHG14044-ANGRBS15396
Человек PACRG Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаHG14044-ANRRBS15396
Человек PACRG Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG14044-CFRBS13340
Человек PACRG Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG14044-CHRBS13340
Человек PACRG Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG14044-CMRBS13340
Человек PACRG Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG14044-CYRBS13340
Человек PACRG Джин клон кДНК в вектор клонированияHG14044-GRBS5132
Человек PACRG Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG14044-NFRBS13340
Человек PACRG Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG14044-NHRBS13343
Человек PACRG Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG14044-NMRBS13343
Человек PACRG Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG14044-NYRBS13340
Человек PACRG Джин ORF экспрессии кДНК клона плазмидыHG14044-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: HG14044-NY
Цена по прейскуранту: 
Цена:      (You Save: )
Размер:
Количество:+-
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
Contact Us
Изображения
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
      Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».