After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Человек P2RX1 Джин ORF экспрессии кДНК клона плазмиды, C-His Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Human P2RX1 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:BC044657
Размер кДНК:1200bp
Описание кДНК:Full length Clone DNA of Homo sapiens purinergic receptor P2X, ligand-gated ion channel, 1 with C terminal His tag.
Синоним гена:P2X1
Виды:Human
переносчик:pCMV3-C-His
Plasmid:
Участок рестрикции:
Последовательность меток:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Человек P2RX1 Джин ORF экспрессии кДНК клона плазмиды, C-His Метка on other vectors
Человек P2RX1 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG15175-ACGRBS15400
Человек P2RX1 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG15175-ACRRBS15400
Человек P2RX1 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG15175-CFRBS13340
Человек P2RX1 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG15175-CHRBS13340
Человек P2RX1 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG15175-CMRBS13340
Человек P2RX1 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG15175-CYRBS13340
Человек P2RX1 Джин клон кДНК в вектор клонированияHG15175-GRBS5130
Человек P2RX1 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG15175-NFRBS13340
Человек P2RX1 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG15175-NHRBS13340
Человек P2RX1 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG15175-NMRBS13340
Человек P2RX1 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG15175-NYRBS13340
Человек P2RX1 Джин ORF экспрессии кДНК клона плазмидыHG15175-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: HG15175-CH
Цена по прейскуранту: 
Цена:      (You Save: )
Размер:
Количество:+-
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
Contact Us
Изображения
      Недавно просмотренные товары
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».