Быстрый заказ

Человек OTC/Ornithine Carbamoyltransferase Джин ORF экспрессии кДНК клона плазмиды, C-His Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Human OTC Информация о продукте «Клон cDNA»
Размер кДНК:1065bp
Описание кДНК:Full length Clone DNA of Homo sapiens ornithine carbamoyltransferase with C terminal His tag.
Синоним гена:OCTD, MGC129967, MGC129968, MGC138856, OTC
Участок рестрикции:
Последовательность меток:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Человек OTC/Ornithine Carbamoyltransferase Джин ORF экспрессии кДНК клона плазмиды, C-His Метка on other vectors
Человек OTC/Ornithine Carbamoyltransferase Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG12057-ACGRBS15400
Человек OTC/Ornithine Carbamoyltransferase Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG12057-ACRRBS15400
Человек OTC/Ornithine Carbamoyltransferase Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаHG12057-ANGRBS15400
Человек OTC/Ornithine Carbamoyltransferase Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаHG12057-ANRRBS15400
Человек OTC/Ornithine Carbamoyltransferase Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG12057-CFRBS13340
Человек OTC/Ornithine Carbamoyltransferase Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG12057-CHRBS13340
Человек OTC/Ornithine Carbamoyltransferase Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG12057-CMRBS13340
Человек OTC/Ornithine Carbamoyltransferase Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG12057-CYRBS13340
Человек OTC/Ornithine Carbamoyltransferase Джин клон кДНК в вектор клонированияHG12057-GRBS5130
Человек OTC/Ornithine Carbamoyltransferase Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG12057-NFRBS13340
Человек OTC/Ornithine Carbamoyltransferase Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG12057-NHRBS13340
Человек OTC/Ornithine Carbamoyltransferase Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG12057-NMRBS13340
Человек OTC/Ornithine Carbamoyltransferase Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG12057-NYRBS13340
Человек OTC/Ornithine Carbamoyltransferase Джин ORF экспрессии кДНК клона плазмидыHG12057-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: HG12057-CH
Цена по прейскуранту: 
Цена:      (You Save: )
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
Contact Us
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.