Быстрый заказ

Человек OTC/Ornithine Carbamoyltransferase Джин ORF экспрессии кДНК клона плазмиды, C-HA Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Человек OTC Информация о продукте «Клон cDNA»
Размер кДНК:1065bp
Описание кДНК:Full length Clone DNA of Homo sapiens ornithine carbamoyltransferase with C terminal HA tag.
Синоним гена:OCTD, MGC129967, MGC129968, MGC138856, OTC
Участок рестрикции:
Последовательность меток:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Описание последовательности:
( We provide with OTC qPCR primers for gene expression analysis, HP101588 )
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Человек OTC/Ornithine Carbamoyltransferase Джин ORF экспрессии кДНК клона плазмиды, C-HA Метка on other vectors
Человек OTC/Ornithine Carbamoyltransferase Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG12057-ACGRBS15400
Человек OTC/Ornithine Carbamoyltransferase Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG12057-ACRRBS15400
Человек OTC/Ornithine Carbamoyltransferase Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаHG12057-ANGRBS15400
Человек OTC/Ornithine Carbamoyltransferase Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаHG12057-ANRRBS15400
Человек OTC/Ornithine Carbamoyltransferase Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG12057-CFRBS13340
Человек OTC/Ornithine Carbamoyltransferase Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG12057-CHRBS13340
Человек OTC/Ornithine Carbamoyltransferase Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG12057-CMRBS13340
Человек OTC/Ornithine Carbamoyltransferase Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG12057-CYRBS13340
Человек OTC/Ornithine Carbamoyltransferase Джин клон кДНК в вектор клонированияHG12057-GRBS5130
Человек OTC/Ornithine Carbamoyltransferase Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG12057-NFRBS13340
Человек OTC/Ornithine Carbamoyltransferase Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG12057-NHRBS13340
Человек OTC/Ornithine Carbamoyltransferase Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG12057-NMRBS13340
Человек OTC/Ornithine Carbamoyltransferase Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG12057-NYRBS13340
Человек OTC/Ornithine Carbamoyltransferase Джин ORF экспрессии кДНК клона плазмидыHG12057-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: HG12057-CY
Цена по прейскуранту: 
Цена:      (You Save: )
Contact Us
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.