Быстрый заказ

Человек OSMR/IL-31RB transcript variant 1 Джин ORF экспрессии кДНК клона плазмиды, N-Flag Метка

  • Cynomolgus CD19/B4/CVID3 Gene Plasmid Map 5623
ПаспортОбзорыСвязанные продуктыПротоколы
Человек OSMR Информация о продукте «Клон cDNA»
Размер кДНК:2946 bp
Описание кДНК:Full length Clone DNA of Homo sapiens oncostatin M receptor1 with N terminal Flag tag.
Синоним гена:OSMRB, MGC75127, MGC150626, MGC150627,
Участок рестрикции:HindIII + XbaI(6kb+2.94kb)
Последовательность меток:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Описание последовательности:Identical with the Gene Bank Ref. ID sequence.
( We provide with OSMR qPCR primers for gene expression analysis, HP101127 )
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Человек OSMR/IL-31RB transcript variant 1 Джин ORF экспрессии кДНК клона плазмиды, N-Flag Метка on other vectors
Человек OSMR/IL-31RB transcript variant 1 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG11226-ACGRBS22240
Человек OSMR/IL-31RB transcript variant 1 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG11226-ACRRBS22240
Человек OSMR/IL-31RB transcript variant 1 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG11226-CFRBS20190
Человек OSMR/IL-31RB transcript variant 1 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG11226-CHRBS20190
Человек OSMR/IL-31RB transcript variant 1 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG11226-CMRBS20190
Человек OSMR/IL-31RB transcript variant 1 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG11226-CYRBS20190
Человек OSMR/IL-31RB transcript variant 1 Джин клон кДНК в вектор клонированияHG11226-MRBS5130
Человек OSMR/IL-31RB transcript variant 1 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG11226-NFRBS20190
Человек OSMR/IL-31RB transcript variant 1 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG11226-NHRBS20190
Человек OSMR/IL-31RB transcript variant 1 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG11226-NMRBS20190
Человек OSMR/IL-31RB transcript variant 1 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG11226-NYRBS20190
Человек OSMR/IL-31RB transcript variant 1 Джин ORF экспрессии кДНК клона плазмидыHG11226-UTRBS20190
 Узнайте больше о векторов экспрессии,
Product nameProduct name

Oncostatin-M specific receptor subunit beta also known as the oncostatin M receptor (OSMR) and Interleukin-31 receptor subunit beta (IL-31RB), is one of the receptor proteins for oncostatin M. OSMR is a member of the type I cytokine receptor family. IL-31RB/OSMR heterodimerizes with interleukin 6 signal transducer to form the type II oncostatin M receptor and with interleukin 31 receptor A to form the interleukin 31 receptor, and thus transduces oncostatin M and interleukin 31 induced signaling events. Mutations in IL-31RB/OSMR have been associated with familial primary localized cutaneous amyloidosis. Defects in IL-31RB/OSMR are the cause of amyloidosis primary localized cutaneous type 1 (PLCA1), also known as familial lichen amyloidosis or familial cutaneous lichen amyloidosis. PLCA1 is a hereditary primary amyloidosis characterized by localized cutaneous amyloid deposition. This condition usually presents with itching (especially on the lower legs) and visible changes of skin hyperpigmentation and thickening (lichenification) that may be exacerbated by chronic scratching and rubbing. The amyloid deposits probably reflect a combination of degenerate keratin filaments, serum amyloid P component, and deposition of immunoglobulins.

  • Arita K, et al.. (2008) Oncostatin M Receptor-β Mutations Underlie Familial Primary Localized Cutaneous Amyloidosis. Am J Hum. Genet. 82 (1): 73-80.
  • Malaval L, et al.. (2005) GP130/OSMR is the only LIF/IL-6 family receptor complex to promote osteoblast differentiation of calvaria progenitors. J Cell Physiol. 204(2): 585-93.
  • Lin MW, et al.. (2010) Novel IL31RA gene mutation and ancestral OSMR mutant allele in familial primary cutaneous amyloidosis. Eur J Hum Genet. 18(1): 26-32.
  • Size / Price
    Каталог: HG11226-NF
    Цена по прейскуранту: 
    Цена:      (You Save: )
    НаличиеIn Stock
    Добавить в корзинуЗапрос по оптовому заказу

    Datasheet & Documentation

    Contact Us
      Недавно просмотренные товары
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.