After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Быстрый заказ

Text Size:AAA

Человек ORM2 Джин ORF экспрессии кДНК клона плазмиды

ПаспортОбзорыСвязанные продуктыПротоколы
Human ORM2 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:BC015964
Размер кДНК:607bp
Описание кДНК:Full length Clone DNA of Homo sapiens orosomucoid 2.
Синоним гена:AGP2, AGP-B, AGP-B', ORM2
Виды:Human
переносчик:pCMV3-untagged
Plasmid:
Участок рестрикции:
Последовательность меток:
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Человек ORM2 Джин ORF экспрессии кДНК клона плазмиды on other vectors
Человек ORM2 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG13299-ACGRBS15400
Человек ORM2 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG13299-ACRRBS15400
Человек ORM2 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG13299-CFRBS13340
Человек ORM2 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG13299-CHRBS13340
Человек ORM2 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG13299-CMRBS13340
Человек ORM2 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG13299-CYRBS13340
Человек ORM2 Джин клон кДНК в вектор клонированияHG13299-GRBS5130
Человек ORM2 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG13299-NFRBS13340
Человек ORM2 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG13299-NHRBS13340
Человек ORM2 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG13299-NMRBS13340
Человек ORM2 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG13299-NYRBS13340
Человек ORM2 Джин ORF экспрессии кДНК клона плазмидыHG13299-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Фон

ORM2 belongs to the calycin superfamily, lipocalin family. Lipocalins share limited regions of sequence homology and a common tertiary structure architecture. They transport small hydrophobic molecules such as steroids, bilins, retinoids, and lipids. Lipocalins can be found in gram negative bacteria, vertebrate cells, and invertebrate cells, and in plants. They are associated with many biological processes. ORM2 functions as transport protein in the blood stream. It is expressed by the liver and secreted in plasma. It seems that ORM2 function in modulating the activity of the immune system during the acute-phase reaction. It binds various hydrophobic ligands in the interior of its beta-barrel domain. It also binds synthetic drugs and influences their distribution and availability.

Ссылки
  • Davila S, et al. (2010) New genetic associations detected in a host response study to hepatitis B vaccine. Genes Immun. 11(3):232-8.
  • Zhang X, et al. (2012) The potential role of ORM2 in the development of colorectal cancer. PLoS One. 7(2):e31868.
  • Size / Price
    Каталог: HG13299-UT
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Размер:
    Количество:+-
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
    Изображения
        Недавно просмотренные товары
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
          Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».