After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Быстрый заказ

Text Size:AAA

Человек OR10H3 Джин ORF экспрессии кДНК клона плазмиды, C-HA Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Human OR10H3 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:BC113844
Размер кДНК:951bp
Описание кДНК:Full length Clone DNA of Homo sapiens olfactory receptor, family 10, subfamily H, member 3 with C terminal HA tag.
Синоним гена:OR10H3
Виды:Human
переносчик:pCMV3-C-HA
Plasmid:
Участок рестрикции:
Последовательность меток:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Человек OR10H3 Джин ORF экспрессии кДНК клона плазмиды, C-HA Метка on other vectors
Человек OR10H3 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG15766-ACGRBS15400
Человек OR10H3 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG15766-ACRRBS15400
Человек OR10H3 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG15766-CFRBS13340
Человек OR10H3 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG15766-CHRBS13340
Человек OR10H3 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG15766-CMRBS13340
Человек OR10H3 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG15766-CYRBS13340
Человек OR10H3 Джин клон кДНК в вектор клонированияHG15766-GRBS5130
Человек OR10H3 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG15766-NFRBS13340
Человек OR10H3 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG15766-NHRBS13340
Человек OR10H3 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG15766-NMRBS13340
Человек OR10H3 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG15766-NYRBS13340
Человек OR10H3 Джин ORF экспрессии кДНК клона плазмидыHG15766-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: HG15766-CY
Цена по прейскуранту: 
Цена:      (You Save: )
Размер:
Количество:+-
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
Contact Us
Изображения
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
      Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».