Optineurin cDNA ORF Clone, Human, N-HA tag

Cat: HG14478-NY

Contact us:

215-583-7898
order_us@sinobiological.com
Distributors

All Optineurin Reagents

CRO Services

Product recommended


All Optineurin Reagents

Optineurin cDNA ORF Clone, Human, N-HA tag General Information

Gene

Species
Human
NCBI Ref Seq
RefSeq ORF Size
1776 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence except for the point mutations: 102A/G not causing the amino acid variation.
Description
Full length Clone DNA of Human optineurin with N terminal HA tag.

Plasmid

Promoter
Enhanced CMV promoter
Vector
Restriction Sites
KpnI + XbaI(6kb+1.78kb)
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.

Screening

Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression

Storage & Shipping

Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

Optineurin cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

Optineurin cDNA ORF Clone, Human, N-HA tag Validated Images

Cynomolgus LOC101926731 Gene Plasmid Map 5628

Optineurin cDNA ORF Clone, Human, N-HA tag Alternative Names

ALS12 cDNA ORF Clone, Human;FIP2 cDNA ORF Clone, Human;GLC1E cDNA ORF Clone, Human;HIP7 cDNA ORF Clone, Human;HYPL cDNA ORF Clone, Human;NRP cDNA ORF Clone, Human;TFIIIA-INTP cDNA ORF Clone, Human

Optineurin Background Information

Optineurin gene encodes the coiled-coil containing protein optineurin. Optineurin may play a role in normal-tension glaucoma and adult-onset primary open angle glaucoma. Optineurin interacts with adenovirus E3-14.7K protein and may utilize tumor necrosis factor-alpha or Fas-ligand pathways to mediate apoptosis, inflammation or vasoconstriction. Optineurin may also function in cellular morphogenesis and membrane trafficking, vesicle trafficking, and transcription activation through its interactions with the RAB8, huntingtin, and transcription factor IIIA proteins. Alternative splicing results in multiple transcript variants encoding the same protein.
Full Name
optineurin
References
  • Rezaie T. et al., 2002, Science. 295 (5557): 1077-9.
  • Li Y. et al., 1998, Mol Cell Biol. 18 (3): 1601-10.
  • Skarnes Wc RB. et al., 2011, Nature. 474 (7351): 337-42.
  • Optineurin cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    Optineurin cDNA ORF Clone in Cloning Vector, Mouse MG53387-U
    Optineurin cDNA ORF Clone, Mouse, untagged MG53387-UT
    Optineurin cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53387-ACG
    Optineurin Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53387-ACGLN
    Optineurin cDNA ORF Clone, Mouse, N-GFPSpark® tag MG53387-ANG
    Optineurin cDNA ORF Clone, Mouse, C-OFPSpark® tag MG53387-ACR
    Optineurin cDNA ORF Clone, Mouse, N-OFPSpark® tag MG53387-ANR
    Optineurin cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG53387-CF
    Optineurin cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG53387-NF
    Optineurin cDNA ORF Clone, Mouse, C-His tag MG53387-CH
    Optineurin cDNA ORF Clone, Mouse, N-His tag MG53387-NH
    Optineurin cDNA ORF Clone, Mouse, C-HA tag MG53387-CY
    Optineurin cDNA ORF Clone, Mouse, N-HA tag MG53387-NY
    Optineurin cDNA ORF Clone, Mouse, C-Myc tag MG53387-CM
    Optineurin cDNA ORF Clone, Mouse, N-Myc tag MG53387-NM

    Optineurin cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    Optineurin cDNA ORF Clone in Cloning Vector, Human HG14478-G
    Optineurin cDNA ORF Clone, Human, untagged HG14478-UT
    Optineurin Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG14478-ACGLN
    Optineurin cDNA ORF Clone, Human, C-GFPSpark® tag HG14478-ACG
    Optineurin cDNA ORF Clone, Human, N-GFPSpark® tag HG14478-ANG
    Optineurin cDNA ORF Clone, Human, C-OFPSpark® tag HG14478-ACR
    Optineurin cDNA ORF Clone, Human, N-OFPSpark® tag HG14478-ANR
    Optineurin cDNA ORF Clone, Human, C-DDK (Flag®) tag HG14478-CF
    Optineurin cDNA ORF Clone, Human, N-DDK (Flag®) tag HG14478-NF
    Optineurin cDNA ORF Clone, Human, C-His tag HG14478-CH
    Optineurin cDNA ORF Clone, Human, N-His tag HG14478-NH
    Optineurin cDNA ORF Clone, Human, C-HA tag HG14478-CY
    Optineurin cDNA ORF Clone, Human, C-Myc tag HG14478-CM
    Optineurin cDNA ORF Clone, Human, N-Myc tag HG14478-NM
    Optineurin qPCR Primer Pairs, Human HP103126
    info info
    添加购物车成功! 添加购物车失败!