Быстрый заказ

Text Size:AAA

Человек OCIAD2 Джин ORF экспрессии кДНК клона плазмиды, C-His Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Human OCIAD2 Информация о продукте «Клон cDNA»
Размер кДНК:300bp
Описание кДНК:Full length Clone DNA of Homo sapiens OCIA domain containing 2 with C terminal His tag.
Синоним гена:OCIAD2
Участок рестрикции:
Последовательность меток:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Человек OCIAD2 Джин ORF экспрессии кДНК клона плазмиды, C-His Метка on other vectors
Человек OCIAD2 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG13996-ACGRBS15400
Человек OCIAD2 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG13996-ACRRBS15400
Человек OCIAD2 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаHG13996-ANGRBS15400
Человек OCIAD2 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаHG13996-ANRRBS15400
Человек OCIAD2 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG13996-CFRBS13340
Человек OCIAD2 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG13996-CHRBS13340
Человек OCIAD2 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG13996-CMRBS13340
Человек OCIAD2 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG13996-CYRBS13340
Человек OCIAD2 Джин клон кДНК в вектор клонированияHG13996-GRBS5130
Человек OCIAD2 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG13996-NFRBS13340
Человек OCIAD2 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG13996-NHRBS13340
Человек OCIAD2 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG13996-NMRBS13340
Человек OCIAD2 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG13996-NYRBS13340
Человек OCIAD2 Джин ORF экспрессии кДНК клона плазмидыHG13996-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.