Быстрый заказ

Человек NUBP2 Джин ORF экспрессии кДНК клона плазмиды

    ПаспортОбзорыСвязанные продуктыПротоколы
    Человек NUBP2 Информация о продукте «Клон cDNA»
    Gene_bank_ref_id:NM_012225.3
    Размер кДНК:816bp
    Описание кДНК:Full length Clone DNA of Homo sapiens nucleotide binding protein 2.
    Синоним гена:CFD1, NBP 2, NUBP1
    Виды:Human
    переносчик:pCMV3-untagged
    Plasmid:
    Участок рестрикции:
    Последовательность меток:
    Описание последовательности:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    ( We provide with NUBP2 qPCR primers for gene expression analysis, HP104927 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Ampicillin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Склад:The lyophilized plasmid can be stored at room temperature for three months.
    Человек NUBP2 Джин ORF экспрессии кДНК клона плазмиды on other vectors
    Человек NUBP2 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG16158-ACGRBS15400
    Человек NUBP2 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG16158-ACRRBS15400
    Человек NUBP2 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаHG16158-ANGRBS15400
    Человек NUBP2 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаHG16158-ANRRBS15400
    Человек NUBP2 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG16158-CFRBS13340
    Человек NUBP2 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG16158-CHRBS13340
    Человек NUBP2 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG16158-CMRBS13340
    Человек NUBP2 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG16158-CYRBS13340
    Человек NUBP2 Джин клон кДНК в вектор клонированияHG16158-GRBS5130
    Человек NUBP2 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG16158-NFRBS13340
    Человек NUBP2 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG16158-NHRBS13340
    Человек NUBP2 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG16158-NMRBS13340
    Человек NUBP2 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG16158-NYRBS13340
    Человек NUBP2 Джин ORF экспрессии кДНК клона плазмидыHG16158-UTRBS13340
     Узнайте больше о векторов экспрессии,
    Product nameProduct name
    Size / Price
    Каталог: HG16158-UT
    Цена по прейскуранту: 
    Цена:      (You Save: )

    Datasheet & Documentation

    Contact Us
      Недавно просмотренные товары
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».