Быстрый заказ

Text Size:AAA

Человек NTNG1/Netrin-G1 Джин ORF экспрессии кДНК клона плазмиды, N-His Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Human NTNG1 Информация о продукте «Клон cDNA»
Размер кДНК:1317bp
Описание кДНК:Full length Clone DNA of Homo sapiens netrin G1 with N terminal His tag.
Синоним гена:Lmnt1, NTNG1
Участок рестрикции:
Последовательность меток:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Человек NTNG1/Netrin-G1 Джин ORF экспрессии кДНК клона плазмиды, N-His Метка on other vectors
Человек NTNG1/Netrin-G1 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG12313-ACGRBS15400
Человек NTNG1/Netrin-G1 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG12313-ACRRBS15400
Человек NTNG1/Netrin-G1 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG12313-CFRBS13340
Человек NTNG1/Netrin-G1 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG12313-CHRBS13340
Человек NTNG1/Netrin-G1 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG12313-CMRBS13340
Человек NTNG1/Netrin-G1 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG12313-CYRBS13340
Человек NTNG1/Netrin-G1 Джин клон кДНК в вектор клонированияHG12313-GRBS5130
Человек NTNG1/Netrin-G1 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG12313-NFRBS13340
Человек NTNG1/Netrin-G1 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG12313-NHRBS13340
Человек NTNG1/Netrin-G1 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG12313-NMRBS13340
Человек NTNG1/Netrin-G1 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG12313-NYRBS13340
Человек NTNG1/Netrin-G1 Джин ORF экспрессии кДНК клона плазмидыHG12313-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: HG12313-NH
Цена по прейскуранту: 
Цена:      (You Save: )
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
Contact Us
      Недавно просмотренные товары
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.