After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Человек METTL11A Джин ORF экспрессии кДНК клона плазмиды, N-Flag Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Human NTMT1 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_014064.2
Размер кДНК:672bp
Описание кДНК:Full length Clone DNA of Homo sapiens N-terminal Xaa-Pro-Lys N-methyltransferase 1 with N terminal Flag tag.
Синоним гена:AD-003, C9orf32, METTL11A
Виды:Human
переносчик:pCMV3-N-FLAG
Plasmid:
Участок рестрикции:
Последовательность меток:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Человек METTL11A Джин ORF экспрессии кДНК клона плазмиды, N-Flag Метка on other vectors
Человек METTL11A Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG11222-ACGRBS15400
Человек METTL11A Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG11222-ACRRBS15400
Человек METTL11A Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаHG11222-ANGRBS15400
Человек METTL11A Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаHG11222-ANRRBS15400
Человек METTL11A Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG11222-CFRBS13340
Человек METTL11A Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG11222-CHRBS13340
Человек METTL11A Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG11222-CMRBS13340
Человек METTL11A Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG11222-CYRBS13340
Человек NTMT1 Gene cDNA clone plasmidHG11222-MRBS5130
Человек METTL11A Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG11222-NFRBS13340
Человек METTL11A Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG11222-NHRBS13340
Человек METTL11A Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG11222-NMRBS13340
Человек METTL11A Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG11222-NYRBS13340
Человек METTL11A Джин ORF экспрессии кДНК клона плазмидыHG11222-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Фон

Methyltransferase-like protein 11A, also known as METTL11A, is a member of the methyltransferase superfamily and METTL11 family. Methyltransferase is a type of transferase enzyme which transfers a methyl group from a donor to an acceptor. Methylation often occurs on nucleic bases in DNA or amino acids in protein structures. Methytransferase uses a reactive methyl group bound to sulfur in S-adenosyl methionine (SAM) as the methyl donor. DNA methylation is often utilized to silence and regulate genes without changing the original DNA sequence. This methylation occurs on cytosine residues. DNA methylation may be necessary for normal growth from embryonic stages in mammals. Methylation can serve to protect DNA from enzymatic cleavage, since restriction enzymes are unable to bind and recognize externally modified sequences. This is especially useful in bacterial restriction modification systems which use restriction enzymes to cleave foreign DNA while keeping their own DNA protected by methylation. Methylation of amino acids in the formation of proteins leads to more diversity of possible amino acids and therefore more diversity of function. The methylation reaction occurs on nitrogen atoms either on the N terminus or side-chain position of the protein and are usually irreversible.

Size / Price
Каталог: HG11222-NF
Цена по прейскуранту: 
Цена:      (You Save: )
Размер:
Количество:+-
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
Contact Us
Изображения
      Недавно просмотренные товары
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».