Быстрый заказ

Text Size:AAA

Человек NT5C1A Джин ORF экспрессии кДНК клона плазмиды, C-His Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Human NT5C1A Информация о продукте «Клон cDNA»
Размер кДНК:1107bp
Описание кДНК:Full length Clone DNA of Homo sapiens 5'-nucleotidase, cytosolic IA with C terminal His tag.
Синоним гена:CN1, CN-I, CN1A, CN-IA, MGC119199, MGC119201, NT5C1A
Участок рестрикции:
Последовательность меток:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Человек NT5C1A Джин ORF экспрессии кДНК клона плазмиды, C-His Метка on other vectors
Человек NT5C1A Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG10462-ACGRBS15400
Человек NT5C1A Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG10462-ACRRBS15400
Человек NT5C1A Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаHG10462-ANGRBS15400
Человек NT5C1A Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаHG10462-ANRRBS15400
Человек NT5C1A Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG10462-CFRBS13340
Человек NT5C1A Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG10462-CHRBS13340
Человек NT5C1A Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG10462-CMRBS13340
Человек NT5C1A Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG10462-CYRBS13340
Человек NT5C1A Джин клон кДНК в вектор клонированияHG10462-MRBS5130
Человек NT5C1A Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG10462-NFRBS13340
Человек NT5C1A Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG10462-NHRBS13340
Человек NT5C1A Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG10462-NMRBS13340
Человек NT5C1A Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG10462-NYRBS13340
Человек NT5C1A Джин ORF экспрессии кДНК клона плазмидыHG10462-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: HG10462-CH
Цена по прейскуранту: 
Цена:      (You Save: )
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
Contact Us
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.