After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Человек NRM/Nurim Джин ORF экспрессии кДНК клона плазмиды, C-HA Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Human NRM Информация о продукте «Клон cDNA»
Gene_bank_ref_id:BC039865
Размер кДНК:789bp
Описание кДНК:Full length Clone DNA of Homo sapiens nurim (nuclear envelope membrane protein) with C terminal HA tag.
Синоним гена:NRM29
Виды:Human
переносчик:pCMV3-C-HA
Plasmid:
Участок рестрикции:
Последовательность меток:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Человек NRM/Nurim Джин ORF экспрессии кДНК клона плазмиды, C-HA Метка on other vectors
Человек NRM/Nurim Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG15159-ACGRBS15396
Человек NRM/Nurim Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG15159-ACRRBS15396
Человек NRM/Nurim Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG15159-CFRBS13343
Человек NRM/Nurim Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG15159-CHRBS13343
Человек NRM/Nurim Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG15159-CMRBS13343
Человек NRM/Nurim Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG15159-CYRBS13343
Человек NRM/Nurim Джин клон кДНК в вектор клонированияHG15159-GRBS5132
Человек NRM/Nurim Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG15159-NFRBS13343
Человек NRM/Nurim Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG15159-NHRBS13343
Человек NRM/Nurim Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG15159-NMRBS13343
Человек NRM/Nurim Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG15159-NYRBS13343
Человек NRM/Nurim Джин ORF экспрессии кДНК клона плазмидыHG15159-UTRBS13343
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: HG15159-CY
Цена по прейскуранту: 
Цена:      (You Save: )
Размер:
Количество:+-
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
Contact Us
Изображения
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
      Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».