NRG3 cDNA ORF Clone, Human, N-Myc tag

Price:
Size:
Number:

NRG3 cDNA ORF Clone, Human, N-Myc tag: General Information

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
2091 bp
Description
Full length Clone DNA of Human neuregulin 3 with N terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

NRG3 cDNA ORF Clone, Human, N-Myc tag: Alternative Names

HRG3 cDNA ORF Clone, Human; pro-NRG3 cDNA ORF Clone, Human

NRG3 Background Information

NRG3 is a member of the neuregulin family of EGF proteins and a ligand for the ErbB4 receptor tyrosine kinase that plays pleotropic roles in neurodevelopment.Neuregulin 3 (NRG3), a brain-enriched neurotrophin, undergoes alternative splicing and is implicated in several neurological disorders with developmental origins. Neuregulin3 (NRG3), a ligand for ERBB4, promotes early mammary morphogenesis and acts during specification of the mammary placode, an aggregate of epithelial cells that forms during mid-embryogenesis.
Full Name
neuregulin 3
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait