Быстрый заказ

Человек NRG-3 / Neuregulin-3 Джин ORF экспрессии кДНК клона плазмиды, N-Myc Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Human NRG3 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_001010848.3
Размер кДНК:2091bp
Описание кДНК:Full length Clone DNA of Homo sapiens neuregulin 3 with N terminal Myc tag.
Синоним гена:HRG3, pro-NRG3
Виды:Human
переносчик:pCMV3-SP-N-Myc
Plasmid:
Участок рестрикции:
Последовательность меток:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Человек NRG-3 / Neuregulin-3 Джин ORF экспрессии кДНК клона плазмиды, N-Myc Метка on other vectors
Человек NRG-3 / Neuregulin-3 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG16071-ACGRBS16760
Человек NRG-3 / Neuregulin-3 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG16071-ACRRBS16760
Человек NRG-3 / Neuregulin-3 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG16071-CFRBS14710
Человек NRG-3 / Neuregulin-3 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG16071-CHRBS14710
Человек NRG-3 / Neuregulin-3 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG16071-CMRBS14710
Человек NRG-3 / Neuregulin-3 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG16071-CYRBS14710
Человек NRG-3 / Neuregulin-3 Джин клон кДНК в вектор клонированияHG16071-GRBS5130
Человек NRG-3 / Neuregulin-3 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG16071-NFRBS14710
Человек NRG-3 / Neuregulin-3 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG16071-NHRBS14710
Человек NRG-3 / Neuregulin-3 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG16071-NMRBS14710
Человек NRG-3 / Neuregulin-3 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG16071-NYRBS14710
Человек NRG-3 / Neuregulin-3 Джин ORF экспрессии кДНК клона плазмидыHG16071-UTRBS14710
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: HG16071-NM
Цена по прейскуранту: 
Цена:      (You Save: )
Размер:
Количество:+-
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
Contact Us
Изображения
      Недавно просмотренные товары
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».