After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Быстрый заказ

Text Size:AAA

Человек NRAS / N-Ras Джин ORF экспрессии кДНК клона плазмиды, C-HA Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Human NRAS Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_002524
Размер кДНК:570bp
Описание кДНК:Full length Clone DNA of Homo sapiens neuroblastoma RAS viral (v-ras) oncogene homolog with C terminal HA tag.
Синоним гена:NS6, ALPS4, N-ras, NRAS1, NRAS
Виды:Human
переносчик:pCMV3-C-HA
Plasmid:
Участок рестрикции:
Последовательность меток:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Человек NRAS / N-Ras Джин ORF экспрессии кДНК клона плазмиды, C-HA Метка on other vectors
Человек NRAS / N-Ras Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG12073-ACGRBS15400
Человек NRAS / N-Ras Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG12073-ACRRBS15400
Человек NRAS / N-Ras Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG12073-CFRBS13340
Человек NRAS / N-Ras Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG12073-CHRBS13340
Человек NRAS / N-Ras Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG12073-CMRBS13340
Человек NRAS / N-Ras Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG12073-CYRBS13340
Человек NRAS / N-Ras Джин клон кДНК в вектор клонированияHG12073-GRBS5130
Человек NRAS / N-Ras Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG12073-NFRBS13340
Человек NRAS / N-Ras Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG12073-NHRBS13340
Человек NRAS / N-Ras Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG12073-NMRBS13340
Человек NRAS / N-Ras Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG12073-NYRBS13340
Человек NRAS / N-Ras Джин ORF экспрессии кДНК клона плазмидыHG12073-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Фон

NRAS was discovered by researchers at the Institute of Cancer Research, funded by the Cancer Research Campaign (now Cancer Research UK). NRAS gene is a member of the Ras gene family. It is mapped on chromosome 1, and it is activated in HL60, a promyelocytic leukemia line. The mammalian ras gene family consists of the harvey and kirsten ras genes (HRAS and KRAS), an inactive pseudogene of each (c-Hras2 and c-Kras1) and the N-ras gene. They differ significantly only in the C-terminal 40 amino acids. These ras genes have GTP/GDP binding and GTPase activity, and their normal function may be as G-like regulatory proteins involved in the normal control of cell growth. The NRAS gene specifies two main transcripts of 2Kb and 4.3Kb. The difference between the two transcripts is a simple extension through the termination site of the 2Kb transcript. The NRAS gene consists of seven exons (-I, I, II, III, IV, V, VI).

Ссылки
  • Marshall CJ. et al., 1982, Nature. 299 (5879): 171-3.
  • Hall Alan. et al., 1983, Nature. 303 (5916): 396-400.
  • McCormick F. 1996, Mol Reprod Dev. 42 (4): 500-6.
  • Size / Price
    Каталог: HG12073-CY
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Размер:
    Количество:+-
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
    Изображения
        Недавно просмотренные товары
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
          Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».