Быстрый заказ

Человек NR3C1 Джин ORF экспрессии кДНК клона плазмиды, C-His Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Human NR3C1 Информация о продукте «Клон cDNA»
Размер кДНК:2334bp
Описание кДНК:Full length Clone DNA of Homo sapiens nuclear receptor subfamily 3, group C, member 1 (glucocorticoid receptor) with C terminal His tag.
Синоним гена:GR, GCR, GRL, GCCR, NR3C1
Участок рестрикции:
Последовательность меток:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Человек NR3C1 Джин ORF экспрессии кДНК клона плазмиды, C-His Метка on other vectors
Человек NR3C1 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG12044-ACGRBS22238
Человек NR3C1 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG12044-ACRRBS16764
Человек NR3C1 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаHG12044-ANGRBS16764
Человек NR3C1 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаHG12044-ANRRBS16764
Человек NR3C1 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG12044-CFRBS14711
Человек NR3C1 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG12044-CHRBS14711
Человек NR3C1 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG12044-CMRBS14711
Человек NR3C1 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG12044-CYRBS14711
Человек NR3C1 Джин клон кДНК в вектор клонированияHG12044-GRBS5132
Человек NR3C1 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG12044-NFRBS14711
Человек NR3C1 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG12044-NHRBS14711
Человек NR3C1 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG12044-NMRBS14711
Человек NR3C1 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG12044-NYRBS14711
Человек NR3C1 Джин ORF экспрессии кДНК клона плазмидыHG12044-UTRBS14711
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: HG12044-CH
Цена по прейскуранту: 
Цена:      (You Save: )
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
Contact Us
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.