Быстрый заказ

Человек NQO1 Джин ORF экспрессии кДНК клона плазмиды, C-His Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Human NQO1 Информация о продукте «Клон cDNA»
Размер кДНК:825bp
Описание кДНК:Full length Clone DNA of Homo sapiens NAD(P)H dehydrogenase, quinone 1 with C terminal His tag.
Синоним гена:DHQU, QR1, DTD
Участок рестрикции:
Последовательность меток:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Человек NQO1 Джин ORF экспрессии кДНК клона плазмиды, C-His Метка on other vectors
Человек NQO1 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG12046-ACGRBS15400
Человек NQO1 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG12046-ACRRBS15400
Человек NQO1 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаHG12046-ANGRBS15400
Человек NQO1 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаHG12046-ANRRBS15400
Человек NQO1 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG12046-CFRBS13340
Человек NQO1 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG12046-CHRBS13340
Человек NQO1 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG12046-CMRBS13340
Человек NQO1 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG12046-CYRBS13340
Человек NQO1 Джин клон кДНК в вектор клонированияHG12046-GRBS5130
Человек NQO1 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG12046-NFRBS13340
Человек NQO1 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG12046-NHRBS13340
Человек NQO1 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG12046-NMRBS13340
Человек NQO1 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG12046-NYRBS13340
Человек NQO1 Джин ORF экспрессии кДНК клона плазмидыHG12046-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name

NQO1 gene is a member of the NAD(P)H dehydrogenase (quinone) family and encodes a cytoplasmic 2-electron reductase. NQO1 forms homodimers and reduces quinones to hydroquinones. NQO1's enzymatic activity prevents the one electron reduction of quinones that results in the production of radical species. Mutations in NQO1 gene have been associated with tardive dyskinesia (TD), an increased risk of hematotoxicity after exposure to benzene, and susceptibility to various forms of cancer. Altered expression of NQO1 has been seen in many tumors and is also associated with Alzheimer's disease (AD). Alternate transcriptional splice variants, encoding different isoforms, have been characterized. Recent pharmacological research suggests feasibility of genotype-directed redox chemotherapeutic intervention targeting NQO1 breast cancer, a common missense genotype encoding a functionally impaired NQO1 protein.

  • Ross David. et al., 2002, J Biol Chem. 277 (16): 14060-7.
  • Cabello CM. et al., 2010, Free Radic Res. 45 (3): 276-92.
  • Adesnik M. et al., 1988, J Biol Chem. 263 (27): 13572-8.
  • Size / Price
    Каталог: HG12046-CH
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.