After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Человек NPTXR Джин ORF экспрессии кДНК клона плазмиды, N-Myc Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Human NPTXR Информация о продукте «Клон cDNA»
Размер кДНК:1503bp
Описание кДНК:Full length Clone DNA of Homo sapiens neuronal pentraxin receptor with N terminal Myc tag.
Синоним гена:NPR
Участок рестрикции:
Последовательность меток:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Человек NPTXR Джин ORF экспрессии кДНК клона плазмиды, N-Myc Метка on other vectors
Человек NPTXR Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG16070-ACGRBS16764
Человек NPTXR Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG16070-ACRRBS16760
Человек NPTXR Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG16070-CFRBS14711
Человек NPTXR Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG16070-CHRBS14711
Человек NPTXR Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG16070-CMRBS14711
Человек NPTXR Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG16070-CYRBS14711
Человек NPTXR Джин клон кДНК в вектор клонированияHG16070-GRBS5132
Человек NPTXR Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG16070-NFRBS14711
Человек NPTXR Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG16070-NHRBS14711
Человек NPTXR Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG16070-NMRBS14711
Человек NPTXR Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG16070-NYRBS14711
Человек NPTXR Джин ORF экспрессии кДНК клона плазмидыHG16070-UTRBS14711
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: HG16070-NM
Цена по прейскуранту: 
Цена:      (You Save: )
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
Contact Us
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.