After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Человек NPM1/Nucleophosmin transcript variant 1 Джин ORF экспрессии кДНК клона плазмиды, N-Flag Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Human NPM1 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_002520
Размер кДНК:885bp
Описание кДНК:Full length Clone DNA of Homo sapiens nucleophosmin (nucleolar phosphoprotein B23, numatrin) with N terminal Flag tag.
Синоним гена:B23, NPM
Виды:Human
переносчик:pCMV3-N-FLAG
Plasmid:
Участок рестрикции:
Последовательность меток:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Человек NPM1/Nucleophosmin transcript variant 1 Джин ORF экспрессии кДНК клона плазмиды, N-Flag Метка on other vectors
Человек NPM1/Nucleophosmin transcript variant 1 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG12074-ACGRBS15400
Человек NPM1/Nucleophosmin transcript variant 1 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG12074-ACRRBS15400
Человек NPM1/Nucleophosmin transcript variant 1 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаHG12074-ANGRBS15400
Человек NPM1/Nucleophosmin transcript variant 1 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаHG12074-ANRRBS15400
Человек NPM1/Nucleophosmin transcript variant 1 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG12074-CFRBS13340
Человек NPM1/Nucleophosmin transcript variant 1 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG12074-CHRBS13340
Человек NPM1/Nucleophosmin transcript variant 1 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG12074-CMRBS13340
Человек NPM1/Nucleophosmin transcript variant 1 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG12074-CYRBS13340
Человек NPM1/Nucleophosmin transcript variant 1 Джин клон кДНК в вектор клонированияHG12074-GRBS5130
Человек NPM1/Nucleophosmin transcript variant 1 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG12074-NFRBS13340
Человек NPM1/Nucleophosmin transcript variant 1 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG12074-NHRBS13340
Человек NPM1/Nucleophosmin transcript variant 1 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG12074-NMRBS13340
Человек NPM1/Nucleophosmin transcript variant 1 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG12074-NYRBS13340
Человек NPM1/Nucleophosmin transcript variant 1 Джин ORF экспрессии кДНК клона плазмидыHG12074-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Фон

Nucleophosmin 1 (NPM1), also known as nucleolar phosphoprotein B23 or numatrin, is a member of the nucleoplasmin family. Nucleophosmin (NPM) is a nucleolar phosphoprotein that plays multiple roles in ribosome assembly and transport, cytoplasmic-nuclear trafficking, centrosome duplication and regulation of p53. The NPM1 gene is frequently involved in chromosomal translocation, mutation and deletion. Mutations of the NPM1 gene leading to the expression of a cytoplasmic mutant protein, NPMc+, are the most frequent genetic abnormalities found in acute myeloid leukemias. Acute myeloid leukemias (AML) with mutated NPM1 have distinct characteristics, including a significant association with a normal karyotype, involvement of different hematopoietic lineages, a specific gene-expression profile and clinically, a better response to induction therapy and a favorable prognosis. In addition, NPM1 is a crucial gene to consider in the context of the genetics and biology of cancer. NPM1 is frequently overexpressed, mutated, rearranged and deleted in human cancer. Traditionally regarded as a tumour marker and a putative proto-oncogene, it has now also been attributed with tumour-suppressor functions.

Ссылки
  • Chen W, et al. (2006) Nucleophosmin gene mutations in acute myeloid leukemia. Arch Pathol Lab Med. 130(11): 1687-92.
  • Naoe T, et al. (2006) Nucleophosmin: a versatile molecule associated with hematological malignancies. Cancer Sci. 97(10): 963-9.
  • Grisendi S, et al. (2006) Nucleophosmin and cancer. Nat Rev Cancer. 6(7): 493-505.
  • Falini B, et al. (2007) Acute myeloid leukemia carrying cytoplasmic/mutated nucleophosmin (NPMc+ AML): biologic and clinical features. Blood. 109(3): 874-85.
  • Meani N, et al. (2009) Role of nucleophosmin in acute myeloid leukemia. Expert Rev Anticancer Ther. 9(9): 1283-94.
  • Size / Price
    Каталог: HG12074-NF
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Размер:
    Количество:+-
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
    Изображения
        Недавно просмотренные товары
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
          Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».