Быстрый заказ

Человек NPM1/Nucleophosmin transcript variant 1 Джин ORF экспрессии кДНК клона плазмиды, C-HA Метка

    ПаспортОбзорыСвязанные продуктыПротоколы
    Человек NPM1 Информация о продукте «Клон cDNA»
    Gene_bank_ref_id:NM_002520
    Размер кДНК:885bp
    Описание кДНК:Full length Clone DNA of Homo sapiens nucleophosmin (nucleolar phosphoprotein B23, numatrin) with C terminal HA tag.
    Синоним гена:B23, NPM
    Виды:Human
    переносчик:pCMV3-C-HA
    Plasmid:
    Участок рестрикции:
    Последовательность меток:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
    Описание последовательности:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    ( We provide with NPM1 qPCR primers for gene expression analysis, HP101603 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Склад:The lyophilized plasmid can be stored at room temperature for three months.
    HA Tag Info

    Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

    The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

    Человек NPM1/Nucleophosmin transcript variant 1 Джин ORF экспрессии кДНК клона плазмиды, C-HA Метка on other vectors
    Человек NPM1/Nucleophosmin transcript variant 1 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG12074-ACGRBS15400
    Человек NPM1/Nucleophosmin transcript variant 1 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG12074-ACRRBS15400
    Человек NPM1/Nucleophosmin transcript variant 1 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаHG12074-ANGRBS15400
    Человек NPM1/Nucleophosmin transcript variant 1 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаHG12074-ANRRBS15400
    Человек NPM1/Nucleophosmin transcript variant 1 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG12074-CFRBS13340
    Человек NPM1/Nucleophosmin transcript variant 1 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG12074-CHRBS13340
    Человек NPM1/Nucleophosmin transcript variant 1 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG12074-CMRBS13340
    Человек NPM1/Nucleophosmin transcript variant 1 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG12074-CYRBS13340
    Человек NPM1/Nucleophosmin transcript variant 1 Джин клон кДНК в вектор клонированияHG12074-GRBS5130
    Человек NPM1/Nucleophosmin transcript variant 1 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG12074-NFRBS13340
    Человек NPM1/Nucleophosmin transcript variant 1 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG12074-NHRBS13340
    Человек NPM1/Nucleophosmin transcript variant 1 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG12074-NMRBS13340
    Человек NPM1/Nucleophosmin transcript variant 1 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG12074-NYRBS13340
    Человек NPM1/Nucleophosmin transcript variant 1 Джин ORF экспрессии кДНК клона плазмидыHG12074-UTRBS13340
     Узнайте больше о векторов экспрессии,
    Product nameProduct name
    Фон

    Nucleophosmin 1 (NPM1), also known as nucleolar phosphoprotein B23 or numatrin, is a member of the nucleoplasmin family. Nucleophosmin (NPM) is a nucleolar phosphoprotein that plays multiple roles in ribosome assembly and transport, cytoplasmic-nuclear trafficking, centrosome duplication and regulation of p53. The NPM1 gene is frequently involved in chromosomal translocation, mutation and deletion. Mutations of the NPM1 gene leading to the expression of a cytoplasmic mutant protein, NPMc+, are the most frequent genetic abnormalities found in acute myeloid leukemias. Acute myeloid leukemias (AML) with mutated NPM1 have distinct characteristics, including a significant association with a normal karyotype, involvement of different hematopoietic lineages, a specific gene-expression profile and clinically, a better response to induction therapy and a favorable prognosis. In addition, NPM1 is a crucial gene to consider in the context of the genetics and biology of cancer. NPM1 is frequently overexpressed, mutated, rearranged and deleted in human cancer. Traditionally regarded as a tumour marker and a putative proto-oncogene, it has now also been attributed with tumour-suppressor functions.

    Ссылки
  • Chen W, et al. (2006) Nucleophosmin gene mutations in acute myeloid leukemia. Arch Pathol Lab Med. 130(11): 1687-92.
  • Naoe T, et al. (2006) Nucleophosmin: a versatile molecule associated with hematological malignancies. Cancer Sci. 97(10): 963-9.
  • Grisendi S, et al. (2006) Nucleophosmin and cancer. Nat Rev Cancer. 6(7): 493-505.
  • Falini B, et al. (2007) Acute myeloid leukemia carrying cytoplasmic/mutated nucleophosmin (NPMc+ AML): biologic and clinical features. Blood. 109(3): 874-85.
  • Meani N, et al. (2009) Role of nucleophosmin in acute myeloid leukemia. Expert Rev Anticancer Ther. 9(9): 1283-94.
  • Size / Price
    Каталог: HG12074-CY
    Цена по прейскуранту: 
    Цена:      (You Save: )

    Datasheet & Documentation

    Contact Us
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».