After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Быстрый заказ

Text Size:AAA

Человек NPDC-1 / NPDC1 Джин ORF экспрессии кДНК клона плазмиды, N-His Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Human NPDC1 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:BC004217
Размер кДНК:978bp
Описание кДНК:Full length Clone DNA of Homo sapiens neural proliferation, differentiation and control with N terminal His tag.
Синоним гена:RNASE6PL, bA514O12.3, RP11-514O12.3, RNASET2
Виды:Human
переносчик:pCMV3-SP-N-His
Plasmid:
Участок рестрикции:
Последовательность меток:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Человек NPDC-1 / NPDC1 Джин ORF экспрессии кДНК клона плазмиды, N-His Метка on other vectors
Человек NPDC-1 / NPDC1 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG13666-ACGRBS15396
Человек NPDC-1 / NPDC1 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG13666-ACRRBS15396
Человек NPDC-1 / NPDC1 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG13666-CFRBS13343
Человек NPDC-1 / NPDC1 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG13666-CHRBS13343
Человек NPDC-1 / NPDC1 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG13666-CMRBS13343
Человек NPDC-1 / NPDC1 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG13666-CYRBS13343
Человек NPDC-1 / NPDC1 Джин клон кДНК в вектор клонированияHG13666-GRBS5132
Человек NPDC-1 / NPDC1 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG13666-NFRBS13343
Человек NPDC-1 / NPDC1 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG13666-NHRBS13343
Человек NPDC-1 / NPDC1 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG13666-NMRBS13343
Человек NPDC-1 / NPDC1 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG13666-NYRBS13343
Человек NPDC-1 / NPDC1 Джин ORF экспрессии кДНК клона плазмидыHG13666-UTRBS13343
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: HG13666-NH
Цена по прейскуранту: 
Цена:      (You Save: )
Размер:
Количество:+-
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
Contact Us
Изображения
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
      Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».